1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
7

The food web illustrated above shows plants and animals, but does not indicate bacteria. If bacteria were truly missing from thi

s food web, what is most likely effect on the community
Biology
1 answer:
Oksanka [162]3 years ago
8 0

Answer: everything that died would not decompose. And that would affect the entire community

Explanation:

You might be interested in
Which are limiting nutrients for plant growth?
Strike441 [17]

Answer:

Nitrogen and phosphorus are among the elements considered most limiting to plant growth and productivity because they are often present in small quantities locally or are present in a form that cannot be used by the plant.

Explanation:

6 0
2 years ago
Using data from the table above, select the best explanation for why that cell will be able to eliminate waste most efficiently?
fomenos
The correct option is this: CELL 2 WILL THE ONE THAT WILL BE ABLE TO ELIMINATE WASTES MOST EFFICIENTLY. This is because it has the highest surface area to volume ratio which facilitates the exchange of materials between a cell and its environment.
The rate of diffusion of materials into and out of the cell depends on the surface area to volume ratio of the cell. The higher this ratio, the higher the rate of diffusion.
6 0
3 years ago
In your future capacity as a healthcare worker, your patients' may depend upon you
Stella [2.4K]

For information to be well made, it is necessary that the doctor has good scientific bases to confirm his information, and good experience in the field.

<h3>How do you know if the doctor is trustworthy?</h3>

To find out if a doctor is qualified to practice the profession, anyone can do a search on the website of the Federal Council of Medicine or the regional councils of medicine in each state.

<h3>What is conveying trust?</h3>

If you need to talk to more people, give a speech or give a speech, for example, a tip to convey confidence is to act out what you are going to say. That way, when you need it, you'll act more safely.

With this information, we can conclude that The personal image is the way you act and express yourself to people, the way you are seen, the perception that the other has of you.

Learn more about health in brainly.com/question/13179079

#SPJ1

3 0
1 year ago
Horseshoe crabs are one of the only five living species of arthropods class
Musya8 [376]
C. Arachnida.
hope it's correct.
6 0
3 years ago
Read 2 more answers
Which of the following behaviors allows a bird to maintain a constant body temperature in extremely hot weather?
patriot [66]
<span>d. All of the above

These behaviors;

Spreading wings
Flattening feathers
panting

are all evolutionary process to maintain body temperature. Birds are warm-blooded animals. Also known as </span><span>homeotherms, which is defined as having the constant body temperature. This is a vital function for the survival of the specie.
</span>
----

<span>c. are hollow
</span>
The bones of most birds are hollow in order for the weight of the birds to be light for them to fly. 
8 0
3 years ago
Other questions:
  • A(n) propagates down an axon of the first neuron like a wave across the ocean until it reached a gap between neurons called
    8·1 answer
  • Why are birds , birds ?
    10·2 answers
  • The locomotion of fibroblasts in culture is immediately halted by the drug cytochalasin, whereas colchicine causes fibroblasts t
    9·1 answer
  • Research has shown that eating too much carbohydrate can cause diabetes.​ <br> a. True <br> b. False
    14·1 answer
  • Why is water considered to be abiotic?
    5·2 answers
  • What role does bacteria and fungi play in an ecosystem?
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • "Which statement concerning the oxygen level in the lake can be inferred from the graphs?
    9·1 answer
  • Which statement is correct about how muscles move bones?
    5·2 answers
  • The speed of sound is:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!