1. Answer;
Light microscope (LM)
Explanation;
-A light microscope (LM) is an instrument that uses visible light and magnifying lenses to examine small objects not visible to the naked eye, or in finer detail than the naked eye allows.
-It allows attachment of the focus wheels and the stage to the microscope. A light source used in place of a mirror. Most microscopes do allow manual light adjustment via a wheel located near the base.
2. Answer;
Scanning electron microscope (SEM)
Explanation;
-A scanning electron microscope (SEM) scans a focused electron beam over a surface to create an image. The electrons in the beam interact with the sample, producing various signals that can be used to obtain information about the surface topography and composition.
-There are two main types of electron microscope; the transmission EM (TEM) and the scanning EM (SEM). The transmission electron microscope is used to view thin specimens (tissue sections, molecules, etc) through which electrons can pass generating a projection image.
Answer:
Option B
Explanation:
Please see the attachment
3)The amount of air that mixes with the gas stream
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Hi!
So there is a need for scientific names, and I'll tell you why.
Scientists and researchers need to have a "universal language", so they can communicate with others around the world. They use scientific names that normally have Latin origins.
The reason we use common names is so people <em>don't </em>get confused. Normal people won't go around saying they need to walk their canis lupus familiaris. They'd say they need to walk their dog.
Hope this helps ya out fam!
~theLocoCoco
