A goniometer measures __________.

Biology

2 answers:

Nostrana [21]3 years ago

5 0

Answer:

a. a joint's maximum range of motion

Explanation:

A goniometer is a device that is used to measure the maximum arc of motion made by a joint. The traditional goniometer consists of a protractor and two extending arms ,one of the arms is movable while the other one is stationary.To take measurements the center of the goniometer is aligned with the center of a joint. Then the arm of the goniometer is moved until it aligns with the limb that has been moved to a maximum position that the joint allows. The angle made between the two arms of the goniometer is measured in degrees and is the maximum range of motion of the joint.

777dan777 [17]3 years ago

4 0

Its used to measure the total amount of available motion at a specific joint
So I guess the answer would be
A. a joints maximum range of motion

You might be interested in

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ

Pani-rosa [81]

The probe would need to bind to the site
TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is complementary and antiparallel to it.

4 0

4 years ago

Which of the following would ATP NOT be used for as energy? A. Push ups B. Keeping warm C. Healing a cut D. Osmosis

Softa [21]

Answer: Osmosis

Explanation:

3 0

3 years ago

Read 2 more answers

What happens to the water contained in the materials that pass into the large intestine?

Gwar [14]

Some is absorbed into our bloodstreams and the rest is eliminated from the body

6 0

3 years ago

The process of chemically digesting protein primarily begins in the stomach. The process continues through the gastrointestinal

Gennadij [26K]

I think the answer is true

5 0

3 years ago

What key traits are specific land plants

morpeh [17]

Answer:

Land plants are multicellular organisms that can be distinguished from other living things by a number of characteristics: They make their own food. Plants are photosynthetic and contain a green pigment called chlorophyll, which enables plants to convert energy from the sun into food. Plants store their food as starch.

Explanation:

You may need to reword it a bit. This should be right.

3 0

3 years ago