1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
9

What is the difference between fern life cycle and moss life cycle??

Biology
1 answer:
Eddi Din [679]3 years ago
7 0

Answer:

Both mosses and ferns undergo alterations of generations. ... The gametophyte is prominent is mosses, but the sporophyte is prominent in ferns. The sporophyte of ferns is differentiated into true leaves, stem, and roots. In contrast, mosses lack true leaves, stem or roots.

Explanation:

You might be interested in
The 5 carbon sugar in dna is called
Kisachek [45]

Answer:

Ribose and Deoxyribose.

Explanation:

They are both important components of nucleotides, and are found in RNA and DNA.

Hope I helped!

7 0
3 years ago
Read 2 more answers
According to the PHS, a "significant financial interest" includes royalty income paid to an investigator and its disclosure is r
Snezhnost [94]

According to the PHS, the term "significant financial interest" includes royalty income paid to an investigator except if that income is from the investigator's current employing institution.

5 0
3 years ago
In order to be considered a living thing, an organism must be able to:
Kazeer [188]
B, reproduce. It is not a living organism if it cannot continue their kind.
7 0
3 years ago
Read 2 more answers
Any relationship in which two species live closely together and at least one of the species benefits
Bingel [31]

Answer:

Symbiosis

both species benefit in this symbiotic relationship

7 0
3 years ago
Read 2 more answers
The most common energy conversion is from _____.heat to mechanicalmechanical to electricalelectrical to chemicalmechanical to he
anastassius [24]
The answer to this question is going to be A


6 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of proteins make up connective tissues?
    7·1 answer
  • I need help I am stuck on this problem
    10·1 answer
  • The human body is composed of cells, organs, organ systems, and tissues. How are these organized?​
    13·1 answer
  • How do you think knowledge of Earth's structure provides insight into how and why these natural events happen?
    6·1 answer
  • Although the citric acid cycle itself does not use O₂, it requires a functioning electron transport chain (which uses O₂) in ord
    5·1 answer
  • HELP PLSSS<br> what are the differences between voluntary and reflex actions?
    6·1 answer
  • During the day, plants produce
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Wich of the following is not a necessary step to take before conducting an experiment
    5·1 answer
  • In order to see cells clearly in a section of plant tissue, which magnification would you have to use? А x5
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!