1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
3 years ago
11

An environmental change causes a decrease in the amount of oxygen that is dissolved in the pond water. Explain why this change w

ould have a greater effect on the frog during the tadpole stage than during the adult stage.
Biology
1 answer:
sleet_krkn [62]3 years ago
4 0

Answer:

during the tadpole stage, they relie on the oxygen in the water to live, unlike frogs in the adult stage who can use the oxygen in the air on land

Explanation:

You might be interested in
Briefly describe what uses the oceans can pose to humanity. Write your response in the essay box below.
Alex17521 [72]

Answer:

Water, fresher climate, not only scientific factors but also a psychological factor (nice beaches, palms, other wildlife, etc.)

3 0
3 years ago
The cellular process of creating two new DNA molecules from one original copy is called replication. Which statement is the BEST
Anni [7]
DNA opens up and each strand is used as template for a new strand.
5 0
3 years ago
Read 2 more answers
What happens to the chromosome number during meiosis?
zysi [14]
It splits in half, it was 46 chromosomes but now it 23 chromosome, one from each gamete cell, one from mum and dad, makes up 46 chromosomes.
3 0
3 years ago
Nutrients that we consume have ____________ energy stored within their chemical ____________ . these nutrient molecules are our
lord [1]

nutrient that we consume have chemical energy  stored within their chemical bond. This  nutrient molecules are our main source of energy for metabolism.

chemical energy is potential of chemical substances to undergo transformation through a chemical reaction to transform other chemical substance. food energy is released during digestion whereby molecules in our food are broken into smaller pieces.As bond between these atom loses a chemical reaction occurs.

3 0
3 years ago
Which part of the adaptive immune response involves b cells?
fomenos

Answer:

Humoral immunity

Explanation:

Adaptive immunity is of two types: cell-mediated immunity and antibody-mediated immunity. Antibody-mediated immunity includes B cells. The function of B cells is to transform into plasma cells which in turn form antibodies. Antibodies are also called immunoglobulins and bind with a specific antigen to generate an immune response. Body fluids or humor include blood and lymph. Since the antibodies bind to the antigens in body fluids (blood and lymph), the antibody-mediated immunity is also called humoral immunity.

3 0
3 years ago
Other questions:
  • The role of the cell membrane is most like the job of which person?
    11·2 answers
  • Scientist have discovered fossils on an island what type of rock for the most likely examining
    6·1 answer
  • Some reptiles, like snakes, have olfactory receptors (smell) _____.
    5·1 answer
  • An important similarity between photosynthesis and cellular respiration is that both processes
    6·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What will happen to the cells of a freshwater plant if the plant is submerged in salt water?
    6·1 answer
  • In your own words, describe the spread of Corona virus and the global response to it.
    15·2 answers
  • What surface cost the least fraction? a. Rock b. Grass c. Dirt d. Ice
    8·2 answers
  • Location where photosynthesis takes place in a cell...
    6·2 answers
  • In humans, brown eyes are dominant over blue eyes. Suppose a blue-eyed woman has children with a brown-eyed man whose mother was
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!