1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
13

Which type of objective lens are there in compound microscope. in one line​

Biology
2 answers:
Tcecarenko [31]3 years ago
7 0
A compound microscope has multiple lenses: the objective lens (typically 4x, 10x, 40x or 100x) is compounded (multiplied) by the eyepiece lens (typically 10x) to obtain a high magnification of 40x, 100x, 400x and 1000x. Higher magnification is achieved by using two lenses rather than just a single magnifying lens.
katrin2010 [14]3 years ago
6 0
A compound microscope has multiple lenses: the objective lens (typically 4x, 10x, 40x or 100x) is compounded
by the eyepiece lens to obtain a high magnification.
You might be interested in
During which process is converted into a sequence amino acks protein production?
3241004551 [841]

Answer:

Protien Synthesis

Explanation:

7 0
3 years ago
Correctly label the anatomical features of the muscle filament.
irina [24]

The labeled anatomical features of the muscle filament are attached as an image.

Muscle filament or Myofilaments are the two protein filaments of myofibrils in muscle cells. The two proteins are myosin and actin and are the contractile proteins involved in muscle contraction.

  • It has two filaments, a thick one made up mostly of myosin, and a thin one composed mostly of actin
  • Actin is a filament made up of protein that contributes to the contractile property of muscle. It is found in two forms, G-actin (monomeric globular actin) and F-actin (polymeric fibrous actin)
  • Tropomyosins are contractile proteins that regulate contraction in both muscle and non-muscle cells with help of myosin and actin filaments. It is present in animal cells.
  • A troponin complex is a group of three proteins, troponin T, troponin I, and troponin C, subunits located on the thin filament of the contractile apparatus.

Thus, the correct labeled anatomical features of the muscle filament is attached as an image.

Learn more about Actin and myosin:

brainly.com/question/13989896

8 0
2 years ago
Why is meiosis not mitosis happening twice?
NeX [460]
They produce two different cells, mitosis produces cells used for growth and repair and each cell is identical to the parent and each other and each contain 46 chromosomes..meiosis produces genetically different daughter cells and there are four cells produced, these cells each contain 23 chromosomes and the cells are used in reproduction
4 0
3 years ago
Read 2 more answers
A karyotype of one of your skin cells would reveal a total of 46 chromosomes. how many of these are maternally inherited autosom
oee [108]
22 numbers of pairs of chromosomes
7 0
4 years ago
5/28 LC-1 Evolution
klio [65]

Answer:

F

Explanation:

F

8 0
2 years ago
Other questions:
  • Which two hypotheses can be supported with quantitative data?
    10·1 answer
  • Using the help of the semi concevative replication of DNA, what is the role of a single strand of DNA
    12·1 answer
  • Which of the following would disappear first in an estuary was destroyed?
    14·1 answer
  • Which action is an effect of lowered inhibitions? (Points : 1) doing or saying things out of line with one’s beliefs or values r
    6·1 answer
  • Nicolaus Copernicus:
    14·1 answer
  • If a child has a disorder called trisomy 16 what is wrong with there cells​
    7·1 answer
  • For this journey you are miniaturized and injected into the interior of the largest bone of your host body, the
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What type of cell is this​
    13·1 answer
  • Ethics focuses on moral issues. Using ethics, people attempt to determine what is good and bad or what is right and wrong.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!