1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olchik [2.2K]
3 years ago
15

Is the Great Green Wall an example of Secondary Succession?

Biology
1 answer:
shusha [124]3 years ago
7 0

Answer:

The Great Green Wall is taking root in Africa's Sahel region, at the southern edge of the Sahara desert. The Great Green Wall is a symbol of hope in the face of one of the biggest challenges of our time - desertification. This game changing African-led initiative aims to restore Africa's degraded landscapes and transform millions of lives in one of the world's poorest regions, the Sahel.

Primary succession occurs on land where no previous growth has taken place and there is no substrate/soil. Secondary succession occurs on land where there has been previous growth, the soil and seed bank makes up the substrate.

Explanation:

I majored in Biology

You might be interested in
What happens to magma during volcanic eruption?​
Andre45 [30]

Answer:

lighter than the solid rock around it, magma rises and collects in magma chambers. Eventually, some of the magma pushes through vents and fissures to the Earth's surface. Magma that has erupted is called lava. Some volcanic eruptions are explosive and others are not.

6 0
3 years ago
Which of the following is false of the integumentary system? A. Too much UV radiation can mutate DNA in skill cells and cause ca
Taya2010 [7]

The statement which is false about the intergumentary system is option D. "Keratin is the pigment responsible for skin color."

Even though the skin color of human beings is affected y different substances, the pigment melanin is responsible for it. Melanin is produced within the skin in cells known as melanocytes and it determines of the skin color of darker-skinned humans.

For instance, the skin color of those who have light skin is determined primary by the bluish-white connective tissue placed beneath the dermis and by the hemoglobin which circulates in the veins of the dermis.

8 0
3 years ago
Read 2 more answers
Please help with my biology
Virty [35]

Answer:

Reptiles, like early dinosaurs.

6 0
3 years ago
Leela is a 16 year old girl free complaint of tiredness and loss of appetite shows unable to concentrate at 4:00 p.m. Thailand a
VLD [36.1K]

Answer:

-Malnutrition ( undernutrition)

Malnutrition  is a condition in which an individual meal contains principally of a particular  class of food, while other classes  are deficient. In this case, Leela ,should be  have consumed too much  rice,CHO( Thailand is associated with high rice production) with less protein and other nutrients .These therefore affects her nutritional and electrolyte balance.

A well balanced diet  which contains all  the needed classes of food in correct proportion should be taken,

6 0
4 years ago
After running, Ollie’s blood pressure was high. As a result, his nervous system sent a message to decrease his heart rate and bl
Colt1911 [192]
What's the question, you didn't specify
9 0
4 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP!!! EMERGENCY!!!
    12·1 answer
  • Example of insulin?i realllllllllllllllllllllllly want to knowwwwwwww
    12·1 answer
  • In a 2009 study, presented by the National Academy of Science, 97% of climate scientists agree that human activity is causing gl
    15·2 answers
  • How do wetlands form
    8·1 answer
  • Are you inferring when you interpret what you have observed?
    11·1 answer
  • What are the organs that comprise the circulatory system?
    10·1 answer
  • sally took antibiotics for several weeks. how would your gut react to the antibiotics after that long
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Question 2: Case 2
    5·1 answer
  • What would be the main role of this molecule?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!