1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
11

What likely determines the phenotype of a given cell?

Biology
1 answer:
kodGreya [7K]3 years ago
8 0

Answer:

Which genes are expressed in that particular cell

Explanation:

Not all genes are expressed at the same time. Distinct gene expression patterns define the identity of each cell.

For example, the genes involved in the function of muscle tissues are only expressed in muscle cells, not in skin cells (and vice versa).

Therefore, the phenotype of the cell is largely determined by the activity of genes in the cell

You might be interested in
There are 14 boys and 7 girls in science class. simplify the ratio
blagie [28]

2:1 would be the ratio of boys to girls

4 0
3 years ago
Explain how our body systems work together to get oxygen into and around our body
Scorpion4ik [409]
Bone marrow baby is a baby from a women that is equal to a monkey
6 0
3 years ago
Read 2 more answers
Need help asap Test!!
ollegr [7]

Answer:

The scientist is studying oxygen which can also be found in protien. oxygen is the element which makes up to 65% of human body mass. It is also found in proteins inside the body.  

7 0
4 years ago
List three machines or devices that depend on gravity to work.
meriva
Gravity is a force which causes objects to fall or be still on the earth's surface. This invisible force has been longed explored mainly by many scientist however, Isaac Newton was first to conceptualize this into a proper principle. 

GravityLight is a device that was recently developed by engineers that is designed to produce light through the force of gravity. 
8 0
3 years ago
What do both the theory of evolution and the cell theory have in common as scientific theories?
malfutka [58]
A) both have strong scientific support.
7 0
4 years ago
Read 2 more answers
Other questions:
  • 1. What special structures are specific to the phylums of Porifera, Cnidaria, Ctenophora, and Platyhelminthes?
    9·1 answer
  • residents of a town are concerned that a recently built factory could pose health risks. Scientists were asked to investigate th
    10·1 answer
  • Cutting down vast tracks of rain forest may result in a loss of all the following environmental effects, except which one?
    6·2 answers
  • How is telomerase activity different from DNA polymerase activity during DNA elongation?
    15·1 answer
  • Is a compound is a pure substance?<br> * I"m just wondering,
    14·2 answers
  • A parabola is defined by the equation (x − 5)2 = 12(y + 2). In which direction will the parabola open
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • the molecule ATP is composed of elements commonly found in organic molecules. which of the following is one of these elements? A
    12·2 answers
  • You are camping in a canyon when a flash flood occurs and you are only able to grab some food before everything else washes away
    10·1 answer
  • Which of the following statements is a correct definition of 'adaptive features'?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!