All categories

3 years ago

In the visual system, the ________ of the eye is filled with a gelatinous material that helps focus light.

Biology

1 answer:

VladimirAG [237]3 years ago

8 0

Answer: Center

Explanation: The space in the center of the eyeball is filled with a clear jelly-like material called the vitreous humor. This material allows light to pass through to the retina. It also helps the eye keep its round shape.

You might be interested in

Maria is testing the behavior of monkeys. First, she shows the monkey a rectangle. Then she shows the monkey a rectangle and a c

aivan3 [116]

Answer:

The correct answer is "temporal lobe".

Explanation:

The temporal lobe is the part of the brain involved in primary auditory perception by receiving sensory information from the ears and secondary areas and translating in into meaningful units such as speech and words. It was proved since 1954 by Mishkin and Pribram that the removal of the temporal lobe part of the brain produces a severe visual discrimination deficit in monkeys. This is the case for Maria's experiment, when the monkey was not able to differentiate between the rectangle and the cylinder anymore. Therefore, it is very likely that the part of the monkey's brain that was removed was the temporal lobe.

7 0

3 years ago

When wearing your seatbelt it should fit ____ and ___ across your waist and across the chest diagonally?

RSB [31]

<span>A seatbelt should be fastened so as to run diagonally across the chest and to fit low and tight across the waist. This ensures that, during the rapid deceleration experienced during a crash, the seatbelt will perform the intended function, that is, to keep the passenger in place within the vehicle.</span>

5 0

4 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What is a macromolecule? Identify the four types of biological macromolecules

insens350 [35]

A macromolecule is a large molecule containing many atoms. The four type are carbohydrates, lipids, proteins, and nucleus acids.

8 0

4 years ago

What is the adaptive advantage of lungs?

Finger [1]

What you meant must be the adaptive advantage of the frogs' lungs. Frogs are considered as amphibians wherein the have this unique ability to reside either on land or in water. Their specialised lungs could be responsible to these which makes them capable of breathing oxygen in water and land.

8 0

3 years ago