1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
4 years ago
8

Describe how a light microscope creates a magnified image

Biology
1 answer:
Angelina_Jolie [31]4 years ago
8 0
 <span>A microscope is an instrument that produces a clear magnified image of an object viewed through it. A microscope must be able not only to magnify objects sufficiently but also to resolve, or separate, the fine details of the object that are of interest to the viewer. In the optical microscope visible light rays, reflected from or transmitted by the viewed object, pass through a series of lenses and form an enlarged image of the object. This image is produced at the normal distance of clearest vision, which is about 10 inches, or 25 centimetres, from the eye of the viewer. 
</span>
You might be interested in
When the stress response is initiated, changes come about because of the activation of a branch of the nervous system called the
rosijanka [135]

Answer:

autonomic nervous system

Explanation:

6 0
2 years ago
Humans cultivate plants that house bacteria in soil to convert ammonia and ammonium ions to ___________________.
Pepsi [2]

Answer:

<em>Humans cultivate plants that house bacteria in soil to convert ammonia and ammonium ions to </em><u><em>nitrate</em></u>

Explanation:

8 0
3 years ago
What detail helps answer the question about Rica’s problem? Add the detail to the chart.
Varvara68 [4.7K]

Answer:

Explanation:

The Answer Is The Principal Sees Rica And Talks to her.

3 0
2 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
The American Academy of Pediatrics recommends that all infants and children, starting shortly after birth, have a minimum daily
garik1379 [7]
<span>The American Academy of Pediatrics recommends that all </span>babies<span> receive </span>vitamin D<span> supplementation (400 IU per day) due to decreased sunlight exposure and an increase in rickets.

Babies need this due to lack of sunlight exposure and is highly recommended if they're breastfed.</span>
5 0
3 years ago
Other questions:
  • A researcher is studying the transport of material within a cell. A microscopic slide prepared using rat liver tissue showed tha
    5·1 answer
  • Digestive systems are susceptible to many diseases. list a disease of the digestive system and explain how you would code for it
    6·1 answer
  • Where do p and S waves travel? (Like through the earth, on its surface, etc)
    6·1 answer
  • What do you think would<br> happen if the cell wall<br> were not functioning?
    10·1 answer
  • Some microbiologists recommend reincubating organisms producing methyl red negative results for an additional 2-3 days. why do y
    13·1 answer
  • Which of the following is true about gene duplications?
    12·1 answer
  • Sean outperforms the other air traffic controllers, accurately detecting three times as many potential airplane space violations
    10·1 answer
  • Where do you find yellow marrow?
    9·2 answers
  • What does the light red layer between the white lumen and blue lamina propria consist of?
    8·1 answer
  • Assertion: Gene mutation is the basis of evolutionary genetic change.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!