1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
5

The phytoplankton in the ocean are able to grow because of energy obtained directly from

Biology
2 answers:
andrezito [222]3 years ago
8 0

i believe the answer is the sun... :)

nadya68 [22]3 years ago
5 0

the sun. phytoplankton are plant like protists.

You might be interested in
What happens in cytokinesis?
xxTIMURxx [149]

Answer:

Cytokinesis is the physical process of cell division, which divides the cytoplasm of a parental cell into two daughter cells. ... The contractile ring shrinks at the equator of the cell, pinching the plasma membrane inward, and forming what is called a cleavage furrow.

Explanation:

hehe plss give me a heart

5 0
3 years ago
Read 2 more answers
Pick all the characteristics below that describe compounds
taurus [48]

Compounds are made up of two or more elements which are chemically bonded. The elements and the properties of the compound are different. Exposure to light and chemical reaction can break compounds into elements. Compounds are only chemically separated not physically. The mass of elements determined the mass of the compound.

6 0
3 years ago
When studying animal behavior, the distribution of organisms within a choice chamber can be studied to identify animal preferenc
Komok [63]

Answer:

c

Explanation:

Random distribution of the Isopods should be 50/50 in A and B.

Chi-square = \frac{(O - E)^2}{E} where O = observed frequency and E = expected frequency

Chamber         O                    E             Chi-square

  A                   18                   10             \frac{(18 - 10)^2}{10} = 6.4

  B                    2                    10             \frac{(2 - 10)^2}{10} = 6.4

<em>Total Chi-square </em>= 6.4 + 6.4 = 12.8

<em>Degree of freedom</em> = 2 - 1 = 1

<em>Tabulated Chi-square</em> (α = 0.05) = 3.8415

The calculated Chi-square exceeds the critical value, hence, it is significant and not due to random.

<em>The correct option is </em><em>c</em><em>.</em>

4 0
3 years ago
The flow of air from land to a body of water is called an
erastova [34]

I believe the answer may be a sea breeze

7 0
3 years ago
The diagram shows the process of meiosis. Which statement is correct regarding meiosis and reproduction? A) Meiosis clones cells
IrinaK [193]

Answer:

C)

Explanation:

Meiosis creates sex cells (gametes) for sexual reproduction. And the resulting daughter cells have have the number of chromosomes as the parent cell.

3 0
3 years ago
Other questions:
  • Immune system cells enter a resting phase after undergoing mitosis. When activated—for example, by an infection—they can reenter
    10·1 answer
  • Which type of selection tends to increase genetic variation? view available hint(s) which type of selection tends to increase ge
    5·2 answers
  • What is the function of the organelles that are labeled F?
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Black is dominant over white in the coat color of guinea pigs. Assume that a cross is made between a hybrid male black guinea pi
    7·1 answer
  • Each level in a food chain contains less energy than the one below it because some energy is
    7·1 answer
  • HELP PLEASE If carrots were removed from the food web, how might the other populations be affected?
    6·1 answer
  • . Which statement accurately describes the energy needs for photosynthesis and cellular respiration?
    9·1 answer
  • Join <br>https://teams.live.com/meet/95183847411242​
    14·1 answer
  • Please help asap tysmm &lt;3333
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!