3 years ago

Which water conservation strategy is used when a household installs a dual flush toilet?

Biology

2 answers:

elena55 [62]3 years ago

7 0

Eliminating Losses

Explanation:

aleksandr82 [10.1K]3 years ago

6 0

Answer:

When a household installs a dual flush toilet, the water is mainly conserved by limiting its consumption and thus eliminates the unnecessary loss of water. #2 is the answer

Explanation:

A dual flush toilet is similar to a standard toilet but includes some water conserving features.

You might be interested in

Which of the following mechanisms is the correct sequence of events that takes place during the plant responses to internal and

patriot [66]

Answer:

C) reception, transduction, and response

Explanation:

Plant signaling means that information is conveyed from receptor systems to effectors within and between plant cells.

Signals can be of chemical form or electrical form.

Plant responses to internal and external signals take place in the following sequence:

Reception

Transduction

Response

So, option C) is correct

7 0

3 years ago

13. This diagram shows which cellular process?

Andrei [34K]

Answer:

Explanation:

6 0

2 years ago

Light energy from the sun is converted by plants into _____.

yan [13]

Chemical energy through the process of photosynthesis.

6 0

3 years ago

Read 2 more answers

What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

3 years ago

Read 2 more answers

Who was the first scientists to classify the elements systematically

Alika [10]

Answer: I believe it was Johann Wolfgang Dobereiner

Explanation:

3 0

3 years ago