1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
drek231 [11]
3 years ago
12

What takes place when you inhale and exhale ?

Biology
2 answers:
Sergio [31]3 years ago
4 0
When we inhale and exhale a process known as breathing takes place. During breathing ; gaseous exchange , that is ; excretion of carbon dioxide and inhalation of oxygen takes place.

Remark : - Dont confuse respiration and breathing. They are different processes. Breathing simply means inhalation of oxygen and exhalation of carbon dioxide ; while respiration means  involves breakdown of food and it is a deeper process.
KiRa [710]3 years ago
4 0
A process called breathing takes place when we inhale oxygen and exhale carbon dioxide .
You might be interested in
Which factor would not limit the production of glucose by photosynthesis in plants
allochka39001 [22]
Chroloplasts---it is important for a plant cell to have a chloroplast in order to create glucose.
4 0
3 years ago
Somatic hypermutation of V genes ​
zaharov [31]

Answer:

Somatic hypermutation is a process in which point mutations build up in the antibody V-regions of both the heavy and light chains.

This process occurs at rates that are about 106-fold higher than the background mutation rates observed in other genes.

It allows B cells to mutate the genes that they use to produce antibodies. This then ensures the B cells to produce antibodies that are better able to bind to bacteria, viruses and other infections.

4 0
3 years ago
What is the receptors?
Sergeu [11.5K]

Answer:

<em>In biochemistry and pharmacology, receptors are chemical structures, composed of protein, that receive and transduce signals that may be integrated into biological systems</em>

3 0
3 years ago
What is the most plentiful fossil fuel? A: oil B:Natural has C: petroleum D: coal
neonofarm [45]

Answer:

d coal

Explanation:

i need more words for it to let me post this answer blah blah

4 0
3 years ago
what is the correct order of processes that occur for water to move from a lake to a cloud and then turn into rain?
yanalaym [24]
1- Evaporation: Energy from the Sun causes water to become vapor and rise into the atmosphere.

2- Condensation: The water is cooled in the temperatures of the lower atmosphere, turning it from vapor into liquid water and collect into clouds.

3- Precipitation: The clouds become too heavy to remain in the sky, and it rains.
3 0
3 years ago
Read 2 more answers
Other questions:
  • How how does hypertension affect the kidney
    5·1 answer
  • Gtpase activity is important in the regulation of signal transduction because it
    11·1 answer
  • Which traits should the student put in section i (inherited)? wolf's social status and blood type skin color and a scar tiger's
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The natural ability of an organism to overcome, suppress, prevent infection, or avoid adverse abiotic factors. For example, some
    8·2 answers
  • What is an advantage of asexual reproduction that is not an advantage of sexual reproduction?
    8·1 answer
  • Which of the following best describes a monomer?
    9·2 answers
  • 1. Why is transport of materials necessary in a plant or an animal? Explain.
    9·1 answer
  • Which is true of a step down transformer but not a step up transformer
    13·1 answer
  • Which diagram shows a possible sequence of steps in the research and development cycle?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!