1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
10

Why is Gregor Mendel considered to be "The Father of Genetics"

Biology
1 answer:
luda_lava [24]3 years ago
6 0
<span>He was the first person to figure out genetics well enough to be able to predict the results of crosses that he made.</span>
You might be interested in
What kind of reservoir shaped a lot of the Grand Canyon? How do you know?
Kaylis [27]
Great reading kid hope u pass
8 0
2 years ago
Read 2 more answers
Glycans are a virulence factor for which group of organisms?
zloy xaker [14]

Answer:

<h3>C.bacteria</h3>

Explanation:

because bacterial glycans are attractive pathogen-specific targets. Bacterial cells are coated with an impressive array of glycan structures that comprise their cell wall

4 0
3 years ago
1.
Alexeev081 [22]

Examples of metabolic processes that occur in living organisms are:

  1. Photosynthesis
  2. Breaking down of lipids

METABOLISM:

  • Metabolism refers to the series of processes that involve the breakdown or build up of molecules to release energy or new products.

  • Metabolism can either be catabolic or anabolic depending on how it occurs.

  • Anabolism is the build up of large molecules from smaller ones while catabolism is the breakdown of large molecules into smaller ones.

  • Example of metabolic processes are photosynthesis, breaking down of lipids.

Learn more at: brainly.com/question/15413788?referrer=searchResults

5 0
2 years ago
How does the sense of vision help maintain equilibrium?
umka21 [38]
The eyes detect changes in posture and inform the brain about the position of the body, so vision is very important for maintaining balance, in the optic disc nerve fibers leave the eye.
7 0
3 years ago
Sex hormones and glucocorticoids are produced in the _________________. These hormones promote normal cell metabolism and help r
ruslelena [56]

Answer

cholesterol

Explanation:

Corticosteroids and sex hormones are derived from cholesterol through the same sterodoigenic pathway, with common metabolic intermediate, progesterone, and are under the control of the hypothalamus–pituitary–adrenal gland (HPA) axis (9).

3 0
3 years ago
Other questions:
  • What parts of the body are classified as connective tissue?
    6·1 answer
  • When does the price of an item decrease?
    15·2 answers
  • example of a decomposer and explain what would happen if decomposers were absent from a forest ecosystem
    9·2 answers
  • generalizations, explanations of natural phenomena, and additional hypotheses most often come about as a result of
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Reptiles have a special egg that feeds their young called a(n)?
    11·1 answer
  • The graph shows the number of accidents for motorcycles with different safety modifications. Based on the graph, which modificat
    12·2 answers
  • While diapering her 1 year old
    9·1 answer
  • Name the respiratory system
    13·1 answer
  • student needs to find the density of a cube. Each side of the cube measures 3 cm, and the mass of the cube is 12 g. What is the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!