1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
10

Which choice is involved in both sexual and asexual reproduction?

Biology
2 answers:
DanielleElmas [232]3 years ago
6 0

The correct answer is:

A.(spores)

I took the test, hope this helps!

serg [7]3 years ago
3 0
I think it’s sperm for your question
You might be interested in
Why are marshes more productive than bogs
ivolga24 [154]

The acidity of the soil-peat inhabits diversity of plant species compared to marshes.

An important distinction to bogs would be that marsh soils are more typically neutral in the pH scale, to slightly more basic.

Hope this helps! If it does, please go to my page and say thanks! Thankyou!

--Emilie Xx

8 0
3 years ago
Read 2 more answers
Because of their increased protein needs, it is unhealthy for athletes to choose to become vegetarians. because of their increas
pav-90 [236]
Athletes need a lot of protein and it is unhealthy for a athlete to become vegetarian Bc they don’t have anything to burn off during the sport
4 0
4 years ago
Read 2 more answers
How is DNA used as a template to make proteins?
Julli [10]
A genes dna is transferred to a molecule called an rna in the cell nucleus. Then the Rna assembles the protein and continues until the ribosomes "stop". 
4 0
3 years ago
The biosphere (life) is composed primarily of water and ____.
ra1l [238]
That would be living things.
Because...
Biosphere= living things
Lithosphere= land
Hydrosphere= water
Atmosphere= air
5 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Which observation tool is the most advanced?
    14·2 answers
  • which procedure is an attampt to correct a getic disordee by replacing a mutated gene with a normal allele
    14·1 answer
  • What is the evolutionary advantage of the heart having its own electrical system?
    6·1 answer
  • Which of the following is NOT
    7·2 answers
  • Rabbit fur color is controlled by a single gene with two alleles displaying complete dominance. A wild rabbit population inhabit
    14·1 answer
  • Why is atmospheric pressure so important for weather forecasting?​
    6·1 answer
  • Every day, Americans use less than 3.5 gallons of water to cook, clean, flush toilets, and bathe.
    5·1 answer
  • Which is likely to be the first organisms to colonize an area after an disturbance like fire?
    14·1 answer
  • Hahahahhahhhzha shshhshs
    13·1 answer
  • What is the complementary strand of the following DNA sequence? ATTGACGTA
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!