Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
llbb
Explanation:
<em>The genotype of the black, short-haired otter could be determined by testing-crossing with a brown, long-haired otter whose genotype would be </em><em>llbb</em><em>.</em>
Analysis of the resulting zygote from the cross would give an indication of the genotype of the otter - whether it has two dominant alleles each for the black, short-hair traits or heterozygous.
<u>If the otter has two dominant alleles for the two traits, all the resulting zygote from the test-cross would have black, short-hair, but if it is heterozygous, a mixed phenotype set of zygote would be obtained.</u>
Answer: C). prolong the effect of epinephrine by maintaining elevated cAMP levels in the cytoplasm
Explanation: In the epinephrine pathway, binding of epinephrine to its receptor triggers a conformational change in the receptor and the interaction of the receptor with its associated Gs protein. This interaction causes the replacement of GDP bound to Gs protein with GTP thus activating the Gs protein. The activation of the Gs protein causes the alpha subunit of the Gs protein to dissociate and move to adenylyl cyclase, another membrane protein in the pathway. The association of the alpha subunit of the Gs protein with adenylyl cyclase activates adenylyl cyclase which in turn catalyzes the synthesis of cyclic AMP (cAMP) a second messenger. cAMP is quickly degraded to 5'-AMP by an enzyme phosphodiesterase. Inhibition of the activity of phosphodiesterase will increase the half life and the cytoplasmic level of cAMP thus potentiating the action of epinephrine.
