Answer:
A worker bee defends the hive while the queen bee lays eggs
A prairie dog barks to alert family members when it spots a predator
Explanation:
Just like people, some animals live in communities, where each of them plays a certain role. For those animals, we can say that they live in a social hierarchy.
Examples that describe something like this are the second and fourth ones.
In a hive, there are different types of bees: workers, drones, and a queen. Each of them plays their role, which makes their hive function properly.
Prairie dogs are another example of species that live in large communities. Since they are small and have numerous predators, they rely on each other for protection. They do this by barking whenever they spot a predator, this way alerting other members of their community.
The rest of the statements simply tell about how some species live without mentioning their social life. This is why they are incorrect.
Barium chloride I looked up the awnser
The ultimate source of energy (for most ecosystems) is "the sun"<span>. The ultimate fate of energy in ecosystems is for it to be lost as heat. Energy and nutrients are passed from organism to organism through the food chain as one organism eats another. Decomposers remove the last energy from the remains of organisms.
Hope this helps!</span>
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
What do you mean by bone?
