1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitrij [34]
3 years ago
15

When fat comes in contact with sodium hydroxide it produces soap and glycerin. Determine wheather this is a physical change or a

chemical change. Explain your answer.
Biology
1 answer:
navik [9.2K]3 years ago
6 0

Answer:

Chemical Change

Explanation:

2 new products emerge

You might be interested in
6. Energy is stored in the form of food.<br><br> Photosynthesis<br> Respiration<br> Both
MArishka [77]

Answer:

Respiration

Explanation:

Food energy is chemical energy that animals (including humans) derive from food through the process of cellular respiration. Cellular respiration may either involve the chemical reaction of food molecules with molecular oxygen (aerobic respiration) or the process of reorganizing the food molecules without additional oxygen (anaerobic respiration).

7 0
3 years ago
Where is the equator of a cell
Alexxandr [17]

Answer:

Where the cell divides

Explanation:

I think the equator, or equatorial plate, is the midline of the cell where duplicated chromosomes position during mitosis.  

8 0
2 years ago
What is the equation for the Krebs cycle?
Dominik [7]

Answer:

Acetyl-Coa + 3 NAD + + Q + GDP + Pi + 2H2O >

CoA-SH + 3 NADH + 3 H + + QH2 + GTP + 2 CO2

Explanation:

8 0
3 years ago
How can you distinguish between animal and plant cells under the microscope?
IRISSAK [1]

Answer:

the shape

Explanation:

If it’s round it would be animal and if it’s square-like it would be plant cell. Hope this helps!

4 0
2 years ago
How does lying on a rock help a turtle maintain homeostasis?
Sholpan [36]

Answer:

It helps them stay safe from predators, weather, or temperature making sure they survive

5 0
3 years ago
Other questions:
  • Which process does the Sun use to produce energy? solar fission solar fusion nuclear fission nuclear fusion
    10·2 answers
  • Which of these materials or structures would be found in greatest amounts or numbers at e? general structure of a neuron showing
    11·1 answer
  • Pollen is carried from one flowering plant to another by
    7·1 answer
  • Which statement best describes the relationship between photosynthesis and cellular respiration
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Explain why a species of barnacles semibalanus balanoides is dominant in areas that are usually under water and another species
    7·1 answer
  • ANSWER QUICK PLEASE which statement describes what the scientist should
    10·1 answer
  • A strand of DNA serves as a model of the synthesis of RNA molecules. is this true or false?
    5·1 answer
  • Invasive species are harmful not because of what they are, but because of
    7·1 answer
  • 1.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!