Answer:cell wall yes plant cell no animal
mitochondria yes both
chloroplasts yes plant cell no animal cell
nucleus yes both
Vacuoles yes both
Lysosomes yes both
Explanation:
Answer:
Carbon, hydrogen, Sulphur, nitrogen, oxygen and phosphorus
Explanation:
Carbon, oxygen and hydrogen are the major components of organic compounds which make up our food. Nitrogen is an essential component of proteins. Sulphur and phosphorous are needed for various body functions.
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
A bladder containing 400 - 500 ml of urine is referred to as functional capacity.
Urine is defined as excess liquid waste products of metabolism in human as well as other animals. The kidneys filter nitrogen rich human metabolism byproducts such as urea and creatinine from blood, then transport it to the ureters, then the urine is excreted from the body via urethra. In order for micturition (a process of excretion of urine from the bladder) to happen, the bladder must maintain a functional capacity at a level of 400 - 500 ml of urine stored inside it, after which the excess level of liquid will be excreted from the body.
To learn more about urine visit: brainly.com/question/21951089
#SPJ4
