1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
11

Decreases efficiency by causing an energy loss to the environment.

Biology
1 answer:
Aleks [24]3 years ago
3 0

Answer:

i like ur pfp

Explanation:

You might be interested in
Which type of carbohydrate appears to lower the risk of hemorrhoids and diverticulitis by adding
kodGreya [7K]

Answer:

dietary fibres

hope it helps

5 0
3 years ago
Read 2 more answers
Somebody help me with this please
Natalka [10]

Answer:cell wall yes plant cell no animal

mitochondria yes both

chloroplasts yes plant cell no animal cell

nucleus yes both

Vacuoles yes both

Lysosomes yes both

Explanation:

5 0
4 years ago
Read 2 more answers
Which of the following are chemicals that all humans need? mark all that apply
ira [324]

Answer:

Carbon, hydrogen, Sulphur, nitrogen, oxygen and phosphorus

Explanation:

Carbon, oxygen and hydrogen are the major components of organic compounds which make up our food. Nitrogen is an essential component of proteins. Sulphur and phosphorous are needed for various body functions.

7 0
3 years ago
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
Pani-rosa [81]
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
4 0
4 years ago
when the bladder contains 400 to 500 ml of urine, this is referred to as specific gravity. anuria. renal clearance. functional c
ExtremeBDS [4]

A bladder containing 400 - 500 ml of urine is referred to as functional capacity.

Urine is defined as excess liquid waste products of metabolism in human as well as other animals. The kidneys filter nitrogen rich human metabolism byproducts such as urea and creatinine from blood, then transport it to the ureters, then the urine is excreted from the body via urethra. In order for micturition (a process of excretion of urine from the bladder) to happen, the bladder must maintain a functional capacity at a level of 400 - 500 ml of urine stored inside it, after which the excess level of liquid will be excreted from the body.

To learn more about urine visit: brainly.com/question/21951089

#SPJ4

4 0
1 year ago
Other questions:
  • Which of the following structures is only a part of male reproductive system in human?
    14·1 answer
  • Hiv is what type of virus that uses rna as its genetic material instead of the more usual dna?
    15·2 answers
  • Compare your observations of micrographs obtained from the optical microscope, the scanning electron microscope, and the transmi
    7·1 answer
  • The spinothalamic tract conducts impulses
    12·1 answer
  • Has anyone ever taken the quiz "Integumentary System 2" for Anatomy and physiology honors
    13·1 answer
  • What is the first part of cell theory?​
    12·1 answer
  • 8. Explain how DNA serves as its own template during DNA replication?
    5·1 answer
  • Define cell and atom​
    7·1 answer
  • What makes stars produce enrgy
    10·2 answers
  • Easy one - giving brainly - show work.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!