1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
4 years ago
7

Obesity does not increase a person's risk for death and disability.

Biology
1 answer:
bazaltina [42]4 years ago
4 0
If this a TRUE/FALSE question, then the answer is that this is FALSE. Obesity would increase the risk for both death and disability for a number of reasons. Obesity increases the risk for heart disease, diabetes, cancer, arthritis, and many other issues.
You might be interested in
The father donates the _______________, and the mother donates the ___________.
balandron [24]

Answer: The father donates the Y chromosomes, and the mother donates the X Chromosomes

Explanation:

5 0
3 years ago
Which of the following statements are true. Chloroplasts are the sites for photosynthesis. Mitochondria specialize in oxidative
Leokris [45]

Answer:

  1. Chloroplasts are the sites for photosynthesis
  2. Mitochondria specialize in oxidative metabolism
  3. Ribosomes are involved in protein synthesis

6 0
3 years ago
Which abiotic factor that would affect the ability of a species of tree to survive in a particular habitat
olga nikolaevna [1]

Answer:

Availability of minerals in the soil

8 0
3 years ago
Of Dang<br> District<br>is the only hill station of<br>Gujarat​
Vedmedyk [2.9K]

Answer:

Saputara Hill Station

Explanation:

Located atop a thickly forested plateau in the Sahyadri range, Saputara is the only hill station in the Dang district in the south of Gujarat.

8 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • A man and his wife both have normal vision, but their son is colorblind. Which parent, the mother or the father gave the son the
    6·2 answers
  • What is the tern used to describe an individual that of a recessive allele that causes disease,but is otherwise healthy?
    13·1 answer
  • Jed was hospitalized for a hip surgery. He is eight years old, and is now exhibiting confusion about the time of day or day of w
    8·1 answer
  • Which scientists played a role in developing the cell theory?
    14·2 answers
  • Where are chloroplasts mostly found?
    13·1 answer
  • Coral reef ecosystems support over a million different species. please select the best answer from the choices provided t f
    12·2 answers
  • List all characteristics that make pasta a living or non living thing
    10·2 answers
  • __________ helps prevent adversary action through the presentation of a credible threat of counteraction. It stems from the beli
    7·1 answer
  • Helpppppppppppppppp
    14·1 answer
  • Russell and Marco are trying to lift their friend Colin onto a tree branch. Russell is pushing
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!