1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olegator [25]
3 years ago
12

Define light year, and explain how and why light years are used to measure distance in the universe

Biology
1 answer:
Paha777 [63]3 years ago
6 0

A light-year is the distance that light travels in empty space in one year. Since the speed of light is about 300,000 km per second (about 186,000 miles per second), then a light year is about 10 trillion kilometers (about 6 trillion miles).

The light year is used in astronomy because the universe is huge. Space objects such as stars and galaxies may be hundreds, thousands or millions of light years away.

You might be interested in
Archimedes' Principle relates primarily to _____. density, mass, boiling and freezing buoyancy.
AleksandrR [38]

Answer:

buoyancy

Explanation:

According to Google "Archimedes' principle states that the upward buoyant force that is exerted on a body immersed in a fluid"

I know a lot on this topic but I wanted to be sure my answer was to the point instead of rambling. If you need further help let me know!

5 0
3 years ago
Read 2 more answers
What are two ways scientists use evidence of past environments preserved in rock?
Aleonysh [2.5K]

I think it is A and D (at least those are the ones that made the most sence to me).

7 0
3 years ago
Read 2 more answers
5 points
Lunna [17]

Answer:

Desert they adapted to survive in the desert

3 0
3 years ago
DNA or protein can be used as a molecule clock that tells how long it has been since two species have diverged from a common anc
Liono4ka [1.6K]

Answer:

DNA or protein can be used as a ''molecular clock'' that tells how long it has been since two species have diverged from a common ancestor. The fossil record is usually derived from sedimentary rocks laid down millions of years ago.

3 0
3 years ago
"Now that you have come up with an equation that describes the relationship between amounts of different nucleotide bases in DNA
Dima020 [189]

Answer:

G - 21%

T - 29%

A - 29%

Explanation:

Nucleotide bases in DNA are complementary. Adenosine (A) binds to Thymine (T) while Cytosine (C) binds to Guanine (G). Hence the composition of A in DNA is the same as that of T; and that of C is the same as that of G.

From the information given, C is 21%

Therefore G is also 21% of the genome as  C is bound to G, the therefore are the same proportion.

C and G make up 42% of the genome (that 21% + 21%).

The remaining 58% (100%-42%) is made up of A + T

Similarly the proportion of A is equal to that of T,

Hence A is 29% (half of 58%) and T is 29%.

4 0
4 years ago
Read 2 more answers
Other questions:
  • What is the reason for agricultural run-off to kill fish in coastal areas that are potentially hundreds of miles from the fields
    7·1 answer
  • Determine whether each phrase describes a community, ecosystem, habitat, or population.
    10·1 answer
  • The eating disorder that is most common among young females who drastically restrict their food intake in an attempt to reduce t
    15·1 answer
  • In a recessive disorder, a person will only have the disorder if they have one copy of the allele
    15·1 answer
  • What part of the brain controls motor functions?
    8·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Expert help: The diagram shows the life cycle of a dragonfly. The adult stage occurs out of the water, and the fertilized egg an
    6·2 answers
  • Help with the order of the food web
    14·2 answers
  • how do oxygen and carbon dioxide cross from the alveoli through the capillary walls and into the blood?
    10·1 answer
  • Please give a short explanation about suspension, colloids, and, solutions.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!