1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
10

What is one use for personality assessments?

Biology
1 answer:
vlabodo [156]3 years ago
3 0

Answer:

Personality assessment is used in wide a range of contexts, including individual and relationship counseling, clinical psychology, forensic psychology, school psychology, career counseling, employment testing, occupational health and safety and customer relationship management.

Explanation:

wiki said so and it worked on my edj :)

You might be interested in
1.
Dvinal [7]

Answer:

I believe that the criminal justice system treats African Americans horribly because of how corrupt and racist the system is.

Things have not improved, hence the black community is being oppressed by all the races who think they are "superior" to African Americans. I believe what requires further attention is justice system and how it should be looked into by the government and how they should work on how they can fix corruption.

4 0
3 years ago
The dancer is this photo has brilliant core and upper body strength. Consider the
Feliz [49]

Answer:

Here :

Explanation:

1.

A. bench press

B. push-ups

C. bicep curl

2.

A. Glute bridge

B. Plank

C. Curl up

3 0
3 years ago
Which of these is a pure substance? Question 3 options: a penny sugar ocean water iced tea
Sphinxa [80]
I believe the answer would be sugar

4 0
3 years ago
Select the correct answer.
iragen [17]

Answer:

Tapeworms are a parasite of humans

Explanation:

Tapeworm infection is caused by ingesting food or water contaminated with tapeworm eggs or larvae. If you ingest certain tapeworm eggs, they can migrate outside your intestines and form larval cysts in body tissues and organs (invasive infection).

8 0
2 years ago
State the ph of the of the digestive system
mojhsa [17]
Hey I don’t really know a lot about this but there teaching me it in my science and math class
3 0
3 years ago
Other questions:
  • Betty has been moody, tired, and weak. there is most likely an abnormality with her _____ gland.
    9·1 answer
  • PLEASE HELP ILL GIVE YOU A LOT OF POINTS
    7·2 answers
  • Can someone help me with this
    8·1 answer
  • Look at the following sequence: THE FAT CAT ATE THE RAT. Delete the first H, and regroup the letters in groups of three, then wr
    10·1 answer
  • Hormones are transported in the blood by red blood cells true or false
    5·1 answer
  • Which macromolecule would be considered as a quick energy source found in pasta and breads?
    11·1 answer
  • What is the main role of the lungs? <br> In your own words please
    11·2 answers
  • Explain how the process of diffusion works and what is needed to make it work
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Pls help! I’m trying to bring my grades up by turning in all my missing assignments but I’m very confused on this.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!