1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
3 years ago
10

How many electrons are in the nucleus of an atom with an atomic number of

Biology
2 answers:
photoshop1234 [79]3 years ago
8 0

Answer:

16( electrons revolving around nucleus)....in nucleus, only protons and neutrons are present....

Explanation:

Formula,

<em><u>No.of protons= No. of electrons= Atomic number</u></em>

please follow me...

VLD [36.1K]3 years ago
6 0

None, Electrons are not in the nucleus

<em>They</em><em> </em><em>are</em><em> </em><em>pres</em><em>ent</em><em> </em><em>in</em><em> </em><em>orbi</em><em>ts</em><em> </em><em>or</em><em> </em><em>ene</em><em>rgy</em><em> </em><em>shells</em><em>.</em><em> </em>

You might be interested in
Gabe's wife wakes him from his peaceful slumber to tell him she heard a noise. As he slowly gets up to investigate, his heart be
allochka39001 [22]

Answer: Clearly his SYMPATHETIC nervous system has been activated.

Explanation:

The effects of the sympathetic nervous system dominate in times of EMERGENCY or STRESS. And its effects include:

- dilation of pupils to help Gabe see sharply as he investigate

- inhibition of saliva secretion as his mouth turns dry

- acceleration of heartbeat due to fear

- stimulation of sweat glands to produce sweat.

All these show clearly that Gabe's SYMPATHETIC nervous system has been activated.

5 0
3 years ago
Please Help!!
Alex

Answer:

1. cell wall, chloroplasts

2. A plant cell is rectangular, while an animal cell is circular. This is because of the cell wall.

3. The function of the chloroplasts is to make sugars and pigments for photosynthesis.

4. The vacuole acts as a storage structure and can hold food for the organism.

Explanation:

6 0
4 years ago
What is the function of the Golgi apparatus? It modifies and stores proteins received from the endoplasmic reticulum. It gives t
tatyana61 [14]
The answer is A.
It modifies and stores proteins received from the endoplasmic reticulum. 
Hope that helped! :)

6 0
4 years ago
Read 2 more answers
Which statement from the passage is the best evidence of Phillips and Lederer's relationship as of 2002?
sveticcg [70]

Answer:

D

Explanation:

Step by Step explanation

5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • One of the genes that controls color vision is found on the X chromosome. The dominant allele results in normal color vision, an
    15·2 answers
  • What are some representative organisms of sponges?
    8·1 answer
  • (Help please?)
    6·2 answers
  • Cook all raw beef, pork, lamb and veal steaks, chops, and roasts to a minimum internal temperature of _____ as measured with a f
    7·1 answer
  • Most "disposable" products _____.
    14·2 answers
  • Tepid moist
    13·1 answer
  • Imagine looking through a microscope at a squashed onion root tip. The chromosomes of many of the cells are plainly visible. In
    11·1 answer
  • 3) What are some examples of alternative energy sources?<br> What are alternative energy sources?
    9·1 answer
  • El jugo de un limón se caracteriza por tener un sabor….
    5·1 answer
  • What happens to a species if an environment changes and there are no variation
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!