1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
5

How is genetic information carried from one organism to its offspring?

Biology
1 answer:
Vika [28.1K]3 years ago
7 0

Answer:

DNA

Explanation:

how does hereditary work?

You might be interested in
Help<br> i don’t understand this question
Setler79 [48]
Yeah same mansion that
5 0
3 years ago
Pablo is sledding down a very steep hill. At which point is Pablo's gravitational potential energy the greatest?
Rasek [7]
When Pablo starts sliding down the hill. As the gravity would pull him towards the ground allowing for him to slide to the very end.
6 0
3 years ago
Read 2 more answers
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
In what ways do mutations change genetic information?
alekssr [168]

Answer:

Each difference in DNA is the result of a mutation

Explanation:

Hope this helps :)

7 0
3 years ago
- What is the function of ATP in living things?*
STatiana [176]

Answer:

C - Capturing, storing, and transferring energy.

Explanation:

ATP is used by cells to store and transport chemical energy. The cells then use this energy to drive cellular functions.

6 0
3 years ago
Read 2 more answers
Other questions:
  • At what temperature does skin death and injury occur
    15·1 answer
  • What type of ion for,s when an atom loses electrons
    12·1 answer
  • Which crystal system has simplest structure
    13·1 answer
  • Which type of molecule makes up the double layer of a cell membrane?
    14·2 answers
  • Which of these is not one of the big six events of human evolution?
    10·1 answer
  • What are some three new things about slavery
    14·2 answers
  • Sulfur combines with atmospheric ______ to form sulfuric acid.
    10·1 answer
  • Animal fats are solid at room temperature because they consist of
    8·1 answer
  • F the cell could no longer produce ATP, what would be the effect on the sarcoplasmic reticulum?
    13·1 answer
  • 57. sea urchin-corals
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!