A citizen will be looking for environmental benefit and public health, which will upsurge the quality of life of the community. The citizen may look for the benefits worth the cost. The CEO of the company might be worried about the costs that appear too high to warrant making environmental initiatives cost-efficient for the business.
A city manager might or need to have the most balanced understanding, desiring to make improvements, which would better the lives of the citizens of the city, but that would keep the city within the municipal budget limits.
5’ tacatgatcatttcacggaatttctagcatgta 3’
3’ atgtactagtaaagtgccttaaagatcgtacat 5’
Only one of the two DNA strands serve as a template for transcription. It is called the template strand or antisense strand of DNA and is read by RNA polymerase from the 3' end to the 5' end during transcription (3' → 5'). However, the complementary RNA is created in the opposite direction, in the 5' → 3' direction, matching the sequence of the sense strand.
Chromosome replication must occur for the process to continue.
Answer: It is a parasitic relation ship
Explanation:
Answer:
The prevailing wind direction is West, even though natural wind direction is East. The West winds prevail because they are much stronger. The way this works is that the San Francisco Bay water is a constant cool temperature (around 50-60 degrees).
Explanation: