1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
4 years ago
13

Repost of last question

Biology
1 answer:
Alex73 [517]4 years ago
6 0

a)mutated sequence DNA GGA GAG TTA

the codons for this sequence, since Guanine(G) pairs with cytosine(C) and adenine(A) pairs with thymine(T) that is replaced with uracil(U) in RNA are

CCU CUC AAU

the amino acids are

Proline-Leucine-Asparagine

b) the initial strand of DNA, GGG GAG TTA

had the complementary strand of RNA:

CCC CUC AAU

the amino acids are

Proline-Leucine-Asparagine

Proline is unchanged and asparagine is unchanged

You might be interested in
Help :<br> c. Vascular plants reproduce by their _______ or ____________ .
andreyandreev [35.5K]

Q: c. Vascular plants reproduce by their _______ or ____________

ans: angiosperms and gymnosperms maybe

3 0
3 years ago
Select the correct answer. A physician examines a patient who complains of breathing problems. She finds fluctuations in the pat
S_A_V [24]
(Medulla oblongata) is the part of the brain which is affected of the patient who is complaining of breathing problems. The (Medulla oblongata) is a vital center which controls visceral activities such as breathing, heart rates, blood pressure, swallowing and vomiting.

Hope This Helps!!
7 0
3 years ago
Read 2 more answers
1st question ??? biology
Kazeer [188]

Answer:

A

Explanation:

Early groups of hunter gatherers continued to move south. They would eventually settle down in areas such as central america, with civilizations such as the Aztecs and the Mayans.

8 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Carboxylic acids tend to release H+ ions more easily than alcohol. Which of the following is the correct explanation for their i
tamaranim1 [39]
Regretfully, you have not included in the question, the choices that would be our guide to arriving in the answer to this query. However, as a general knowledge, the acidity of a substance can be measured by its pH which is equal to,
                          pH = -log[H+]
which means that the increase in H+ ions will lead to the decrease in pH. A smaller pH value denotes that the substance is more acidic. 
8 0
3 years ago
Other questions:
  • What is the function of restriction endonucleases in bacteria?
    5·1 answer
  • Why can the mrna strand made during transcription be thought of as a mirror image if dna strand rom which it was made?
    9·1 answer
  • Lions, giraffes, and zebra occupy the tropical grassland, also known as the ______.
    9·1 answer
  • 1. The concept of the atom has been around for?
    10·1 answer
  • Malthus studied limited resources and the impact of limited resources on human populations. How did these ideas contribute to Da
    6·2 answers
  • A _______ can be defined as a basic unit of hereditary information that influences a particular trait or group of traits.
    5·2 answers
  • Pls create a Eulogy about a cell organelle (lysosomes) I will give Brainliest answer
    10·1 answer
  • What elements are found in carbohydrates
    13·1 answer
  • 22. An individual who participates in a long-distance run on a hot day will produce large
    12·1 answer
  • Write two sentences or clues, one for each word, that will help you remember the difference between actin and myosin. (Example:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!