Answer:ketosis
Explanation: individuals experience a state of ketosis in the morning even afyer eating a carbohydrate-containing meal the previous evening. Ketosis is a state of metabolism in which there is very little glucose in the body, therefore, fat acs to provide energy to the body. Although ketosiz is mostly experienced in cases of low-carbohydrate diets, it also occurs in cases of pregnancy, infacny or in lactating mothers. Such cases are termed physiologic ketosis.
Nice djjsjeejjsjdjdjjdjjdjsjs
So, "weather is the day-to-day state of the atmosphere, and its short-term variation in minutes to weeks. People generally think of weather as the combination of temperature, humidity, precipitation, cloudiness, visibility, and wind. But climate is the weather of a place averaged over a period of time, often 30 years." Hope I helped!
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Manure is better than fertiliser. Manure is derived naturally and adds a lot more than just nutrients to the soil. They increase the activity of the microbes in the soil and increase its fertility. On the other hand, fertilisers harm these microbes and cause health issues in the consumers since they are synthesised chemically.
