1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
6

Pajaki w moim domu sprzymierzency czy wrogowie ​

Biology
1 answer:
tester [92]3 years ago
5 0

Answer:

Ummmmmmmmmmmmmm

You might be interested in
When rounding to the nearest 10 what is the greatest whole number that rounds to 7670​
valentina_108 [34]
7669; since we are looking for the nearest 10’s we look at the last two digits, it’s 70, so all we need to do is go down 1 to have the “greatest whole number” ;)
4 0
3 years ago
3. Plants which were grown in the past and have been bred to adapt to a specific
Sladkaya [172]

Answer: A. Heirloom crops

4 0
3 years ago
You must draw a Punnett square and work out these problems to get the correct answers. In cats, long-hair (H) is dominant to sho
Lana71 [14]

Answer:

The correct answer is -

Genotypes: 1 heterozygous dominant: 1 recessive

Phenotypes: 1 long hair cat: 1 short hair cat

probability: 50% chances of both long and short hair cats

Explanation:

It is given that long hair is a dominant represented by H, over the short hair represented by h. In the cross of a heterozygous cat for long hair with a cat with short hair, would produce H, h and h, h gametes respectively.

Cross: Hh × hh

    H    h

h    Hh   hh

h   Hh   hh

In this Punnett, there are two heterozygous long hair offspring produced and two short-hair cats.

So, Genotypes: 1 heterozygous dominant: 1 recessive

Phenotypes: 1 long hair cat: 1 short hair cat

probability: 50% chances of both long and short hair cats

7 0
3 years ago
1.2.4 Quiz: Principles of Heredity
sergeinik [125]

Answer:

A form of a gene

Explanation:

7 0
3 years ago
Hunter syndrome is a rare genetic disorder in which large sugar molecules called glycosaminoglycans build up in body tissues. Hu
tangare [24]

Answer:

Hunter syndrome is a very rare, inherited genetic disorder caused by a missing or malfunctioning enzyme. In Hunter syndrome, the body doesn't have enough of the enzyme iduronate 2-sulfatase.

7 0
1 year ago
Other questions:
  • In a nursing class the instructor explains the vulnerability of the organ systems during formation, such as the respiratory and
    9·1 answer
  • Which statement is an example of mutualism?
    10·1 answer
  • How does carbon enter plants?
    14·2 answers
  • Chromoplasts, which store starch, are most abundant in roots and tubers
    10·1 answer
  • The first level in the PLISSIT model involves _______
    8·1 answer
  • What important trait do all Protists share
    7·1 answer
  • What is the difference between food chain and food Web<br>​
    10·1 answer
  • (ANSWER NEEDED TODAY) Why is it important for cells to become specialised?
    7·1 answer
  • Which of the following are taxonomic kingdoms? Select all that apply. Plantae Animalia Mammalia Protista Reptilia Fungi Archae E
    13·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!