1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
3 years ago
10

Dogs can inherit four features: fur pattern, fur length, ear length, and tail length. The alleles are expressed as shown:

Biology
1 answer:
Thepotemich [5.8K]3 years ago
7 0

Explanation:

Which two details from the short story excerpt BEST support the correct answer above? A) "As if that could have anything to do with --with--My, wouldn't they laugh?" (section 1) "But you know juries when it comes to women. If B) there was some definite thing--something to show." (section 2) "No, Mrs. Peters doesn't need supervising. For that matter, a sheriff's wife is married to the law." (section 3) D) Then Martha Hale's eyes pointed the way to the basket in which was hidden the thing that would make certain the conviction of the other woman-- (section 4) Martha Hale snatched the box from the sheriff's wife, and got it in the pocket of her big coat just as the sheriff and the county attorney came back into the kitchen (section 5) E)

You might be interested in
The most common map projections are based on three geometric shapes. Which of the following geometric shape is not one of the th
leonid [27]

A geometric shape is the geometric information which remains when location, scale, orientation and reflection are removed from the description of a geometric object. ... Such shapes are called polygons and include triangles, squares, and pentagons.

3 0
3 years ago
What is a derived trait?
Agata [3.3K]

Answer:

A.

Explanation:

Because the trait undergoes a secondary loss; it has been there but it doesn't always appear in all generations.

8 0
3 years ago
What is a membrane lipids?
Yuri [45]
A membrane lipid is a compound which belongs to a group of (structurally similar to fats and oils) which form the double-layered surface of all cells (lipid bilayer). The three major classes of membrane lipids are phospholipids, glycolipids, and cholesterol.
4 0
3 years ago
Read 2 more answers
Arrange the order of events for the internalization of LDL particles into cells:
ElenaW [278]

Answer:

The correct answer is "5-1-3-2-4".

Explanation:

Internalization of LDL particles into cells, is needed to form the intracellular vesicles known as endosomes. The order of events that allow for this process are:

5) LDL receptors migrate to the cell surface and cluster in clathrin-coated pits. Clathrin acts directing the receptors to the cell membrane region where endosomes are formed.

1) A combination of cholesterol and apolipoprotein binds to LDL receptors and becomes internalized as endocytotic vesicles. Once the receptors are in the proper cell membrane region, cholesterol and apolipoprotein are bound and internalized.

3) Several endocytotic vesicles fuse to form an endosome.

2) The environment of the endosome becomes acidic, which causes the LDL to dissociate from its receptor; additionally, the endosome fuses with a lysosome. LDL should be dissociated from its receptor since it is going to be degraded in the following step.

4) The LDL particle is degraded by the lysosome. This takes place after endocytosis, when LDL particles are transported into lysosomes once they are fused, cleaving the cholesterol esters into cholesterol and fatty acids.

6 0
3 years ago
What are the components of animal cell
Phoenix [80]
<span>The components of animal cells are centrioles, cilia and flagella, endoplasmic reticulum, golgi apparatus, lysosomes, microfilaments, microtubules, mitochondria, nucleus, peroxisomes, plasma membrane and ribosomes. Lol I hope this is what you were looking for!</span>
7 0
3 years ago
Other questions:
  • What are chromosome
    5·2 answers
  • Fermentation is carried out regularly, and not only during oxygen emergencies, by what organisms?
    13·2 answers
  • In humans, slow fibers are not found in the muscles of the
    5·1 answer
  • Please describe the environmental issue in Borneo concerning conservation of the rainforest (a global hot spot) and the oranguta
    5·1 answer
  • 15. DNA replication is said to be semi-conservative. What does that mean?
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Describe how tissue fluid and lymph fluid form and explain lymph function​
    10·1 answer
  • What are the 3 ways in which static electricity can be transferred? Explain each.
    11·1 answer
  • Explaining hardy Weinberg equilibrium and the eastern squirrel/ how many in the population have the following genotypes
    6·1 answer
  • I WILL GIVE BRAINLIEST!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!