1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
2 years ago
9

Helppp please :( need to pass this quiz ASAP

Biology
1 answer:
Evgesh-ka [11]2 years ago
5 0

2Al2O3-->4Al+3O2

next time find the correct category to ask questions

You might be interested in
CAN SOMEONE ANSWER THESE QUESTIONS I WILL GIVE BRAINLIEST PLEASEEEE
Vadim26 [7]
28. bacteria and fungi.
29. answer 3
30. answer 2
5 0
3 years ago
Read 2 more answers
How does DNA help with the transfer of genetic material from parents to offspring?
earnstyle [38]
<span>Genetic material is passed down from parents to offspring by DNA. The DNA copies itself and the number of chromosomes is split in the half from 46 to 23 chromosomes.</span>
7 0
3 years ago
Glycogen in _____ is broken down and released into blood when blood glucose is low.
WINSTONCH [101]
A is the of this question.
5 0
3 years ago
Mutations in what class of genes have probably been responsible for many of the changes leading to the great diversity of life e
vampirchik [111]
Yes but cells also help get life to where it is right now and cells will also be changing genes connect with who we are and what we are and without those genes and cells we wouldn't be who we are today. genes do regulate mitosis but not for aerobic respiration genes give use our characteristics like girl,boy. DNA does help repair genes like per say you got a scrape on your leg or arm the DNA would clot so that the bleeding would stop and that would cause it to scab over.

8 0
3 years ago
Humans can maintain a stable internal temperature by?
Lerok [7]

Answer:

A

Explanation:

your body temp get to room temp by fever to fight off infection

8 0
3 years ago
Other questions:
  • Which of the following is an example of reproductive isolation?
    15·1 answer
  • The traditional “top-down” theory of the formation of our galaxy cannot explain why
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which is NOT a shared characteristic of all chordates?
    10·2 answers
  • How long can you leave uncooked potatoes in water?
    6·1 answer
  • Which is true with respect to the kinetic energy of a molecule?
    9·2 answers
  • Using the triple beam balance scale to find the mass of an object the first beam is 100, the second is 40 and the third is 7.2.
    5·1 answer
  • The author writes, “Gerardo Ceballos, a researcher at the Universidad Nacional Autonoma de Mexico in Mexico City, acknowledged t
    11·1 answer
  • Burning oil and coal adds ______ to the atmosphere.
    15·1 answer
  • Mitosis is a type of cell division that produces cells that are used for growth and repair. Meiosis is a different type of cell
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!