1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
Which statement explains why approximately half of an individual’s DNA sequence comes from each parent?A. A cell from one parent
Inessa [10]

Answer:

I believe the answer is D, if I’m wrong please tell me!

it might be a.

3 0
2 years ago
Scientists have discovered a fossil skeleton of a whale-like creature that lived in the early Eocene epoch. The skeleton shows a
soldier1979 [14.2K]
A. Ancestors of whales may once have been able to walk.
4 0
3 years ago
Read 2 more answers
How does DNA replication take place ?
attashe74 [19]

The initiation of DNA replication occurs in two steps. First, a so-called initiator protein unwinds a short stretch of the DNA double helix. Then, a protein known as helicase attaches to and breaks apart the hydrogen bonds between the bases on the DNA strands, thereby pulling apart the two strands.


So yeah xD


~ Hope this helps! -by Kana ^^

4 0
3 years ago
Which division of the peripheral nervous system activates skeletal muscles?
VladimirAG [237]

Answer: Somatic nervous system  

Explanation:

The voluntary nervous system or somatic nervous system the part of the PNS (peripheral nervous system) which is associated with the voluntary control of the body movements.

These movements are generally controlled by the skeletal muscles. It helps in various movements such as walking, bending, sitting, et cetera.

This nervous system consists of the efferent nerves and afferent nerves or we can say motor nerves that helps in controlling the movement of the body.

8 0
3 years ago
What protects the stomach from acidic gastric juices?
Murljashka [212]
Mucous cells is what I think is the answer. hope it helps ;)
5 0
3 years ago
Read 2 more answers
Other questions:
  • There is a drought in an area in which white-tailed deer live. classify the drought as a density-independent factor or a density
    9·2 answers
  • How does connective tissue differ from the other three major tissue types? how does connective tissue differ from the other thre
    6·1 answer
  • Is endocytosis active or passive transport
    6·1 answer
  • PLEASEEEEEEEE HELP!!!
    6·1 answer
  • How does the structure of epithelial tissue help it to perform its function?
    8·2 answers
  • 1.
    5·1 answer
  • Why does the male parent's genes determine the sex of the baby?
    6·2 answers
  • Why are certain bacterial infections difficult to treat with antibiotics? A) The bacteria are complex and require fungicides ins
    6·1 answer
  • Large numbers of ribosomes are present in cells that specialize in producing ___________molecules
    13·1 answer
  • What’s a 631 in osmosis Jones
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!