1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
2 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]2 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
Ridha observed that fishes were coated with salt and kept in tray in the fish market. What is the likely use of coating fish wit
Katena32 [7]

The likely use of coating fish with salt is to stop the growth of bacteria by reducing the moisture content (option B).

<h3>What is preservation?</h3>

Preservation is the judicious and wise use of resources to prevent them from spoilage or harm caused by pests and diseases.

According to this question, Ridha observed that fishes were coated with salt and kept in tray in the fish market.

Based on the above description, the method of preservation used is salting, which is act of sprinkling salt, either on food, or on an icy road to reduce moisture content of the substance.

Therefore, the likely use of coating fish with salt is to stop the growth of bacteria by reducing the moisture content.

Learn more about salting at: brainly.com/question/5306491

#SPJ1

3 0
1 year ago
There are well over 600 skeletal muscles in the human body.<br><br> true <br> false
dangina [55]
The answer is True, i think there are about 700
4 0
3 years ago
Plant species A has a diploid number of 12. Plant species B has a diploid number of 16. A new species, C, arises as an allopolyp
marishachu [46]

the answer would be d i'm pretty sure.. i could be wrong tho..

5 0
3 years ago
What are some ways we can monitor earthquakes ?
Vinil7 [7]
Scientists currently monitor underground movements, such as earthquakes and nuclear tests, using seismometers – instruments that measure the motion of those events at the Earth's surface.
7 0
2 years ago
Read 2 more answers
Based on the concept of phylogeny, an organism that was ancestral to both the bacteria and eukaryota domains would exhibit which
Helen [10]
"It would have DNA." is the one among the following characteristics that would be exhibited based <span>on the concept of phylogeny, an organism that was ancestral to both the bacteria and eukaryota domains. The correct option among all the options that are given in the question is the third option or option "C". </span>
5 0
2 years ago
Read 2 more answers
Other questions:
  • How do humans increase the natural amount of carbon dioxide in the atmosphere
    5·2 answers
  • How would you break the carbohydrate protein and lipid molecules apart?
    10·1 answer
  • Please test tomorrow:the process in which particles move through a membrane from a region of high concentration to a region of l
    10·1 answer
  • According to the fossil record, which statement
    15·2 answers
  • Corals use harpoon-like to catch food
    6·1 answer
  • Cigarette smoking is a factor in causing all of the following conditions except
    6·2 answers
  • Describe the levels of organization of an organism that lives in your biome ?
    6·1 answer
  • Frogs are primary and secondary consumers or secondary and tertiary consumers?
    5·1 answer
  • Interstellar clouds of dust where stars form are known as
    5·1 answer
  • The picture has the question in it
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!