1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
6. Two pink flowers are crossed. There are 40 offspring which consist of red flowers (RR), white flowers(WW) and pink flowers (R
anyanavicka [17]

two. pink. flowers are crosswd there are 40 offspring which consist of red flowers

7 0
2 years ago
6. Explain how the equations for photosynthesis and cellular respiration compare.
SOVA2 [1]

The products of one process are the reactants of the other. Notice that the equation for cellular respiration is the direct opposite of photosynthesis: Cellular Respiration: C6H12O6 + 6O2 → 6CO2 + 6H2O. Photosynthesis: 6CO2 + 6H2O → C6H12O6+ 6O.

3 0
3 years ago
Which of the following statements about energy is TRUE? Question 17 options: It can be used over and over again. It tends to be
Law Incorporation [45]
<h2>Energy </h2>

Explanation:

Energy flows in only one direction through an ecosystem

  • The Sun supports most of Earth's ecosystems
  • Plants create chemical energy from abiotic factors that include solar energy and chemosynthesizing bacteria create usable chemical energy from unusable chemical energy
  • The food energy created by producers is passed to consumers, scavengers, and decomposers
  • Energy flows through an ecosystem in only one direction, it is passed from organisms at one trophic level or energy level to organisms in the next trophic level
  • Most of the energy at a trophic level – about 90% – is used at that trophic level and organisms need it for growth, locomotion, heating themselves, and reproduction
  • So animals at the second trophic level have only about 10% as much energy available to them as do organisms at the first trophic level
  • Animals at the third level have only 10% as much available to them as those at the second level
6 0
3 years ago
What is the cellular make-up of animalia
ivann1987 [24]

Answer:

The kingdom Animalia, or Metazoa, includes all animals. Animals are multicellular, eukaryotic organisms, which are heterotrophic, meaning they obtain nutrition from organic sources.

Explanation:

you welcome plz mark as brainlest

7 0
3 years ago
Please help will give brainless !!!!!:)
Anestetic [448]

Answer:

they start to run out of places to stay cool and then will eventually run out of food to eat then they will die. hope this helps

7 0
3 years ago
Other questions:
  • In the sodium-potassium pump, how many sodium ions are moved AND what direction do they<br> move?
    10·1 answer
  • Similarity of structures due to common ancestry is called
    10·1 answer
  • What happen when forced on an object are balanced
    9·1 answer
  • Identify what structures in a skeletal muscle will shorten in length during contraction of the muscle.
    14·1 answer
  • Why might a scientist repeat an experiment if he/she didn't make a mistake in the first one? An experiment should be repeated to
    14·2 answers
  • 1000 individuals 500 new and 2000 died in one year. What is the equation to show population growth
    13·1 answer
  • What adaptations would be found in leaves located in a desert, tropical rain forest, and aquatic environment?
    15·1 answer
  • NEED ASAP! Lividity in a dead body is caused by capillaries decaying due to de-oxygenation
    15·1 answer
  • URGENT!!!!!!!!!!!!!
    15·1 answer
  • Could someone give me some help on the last question of #6. I would say no, but I don’t know for sure.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!