1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
One group of students uses different methods to conserve water in the garden as listed below. Method 1: Water the garden when th
sweet [91]
I think method 2 and method 3
3 0
2 years ago
Read 2 more answers
What is the correlation between women’s education and family size?
Serhud [2]

A negative correlation is most clearly seen between different levels of female education and the total fertility rate (TFR) in a population. TFR is the number of children a woman can expect to have over her lifetime given current rates of age-specific fertility.

Hope i answered right!!!

4 0
3 years ago
g Glycogen Phosphorylase is phosphorylated by ____________________. Glycogen Synthase Kinase Casein Kinase Protein Kinase G Phos
Bumek [7]

Answer:

Phosphorylase kinase

Explanation:

Phosphorylase kinase is a type of regulatory protein kinase which helps in the process of glycogen breakdown.

It sends signals and the process of phosphorylating occurs which then helps in the activation of glycogen phosphorylase and subsequent breakdown of glycogen in the body. This makes phosphorylase kinase the right option.

3 0
3 years ago
What is newtons first law​
dsp73

Answer:

An object at rest stays at rest and an object in motion stays in motion with the same speed and in the same direction unless acted upon by an unbalanced force.

Explanation:

no explanation needed.

5 0
2 years ago
Why organisms typically adapt over time?
trasher [3.6K]
Organisms is an environment or habitat for species hope this help
6 0
3 years ago
Other questions:
  • An Arizona desert measures 50 square kilometers. A botanist recorded that there are 150 Saguaro cactus plants within the desert
    11·1 answer
  • Help me asap please
    6·1 answer
  • What is the answer to 4?
    12·1 answer
  • Long-term memory may involve
    14·2 answers
  • What do the gas giants have in common
    13·1 answer
  • A tide is
    12·1 answer
  • Which is a tough and flexible layer that surrounds plant cells, as well as some algal and bacterial cells?
    15·2 answers
  • Why does DNA replicate itself?
    14·1 answer
  • Definition of invasive species ?
    14·2 answers
  • Lilah’s family has a large garden in their backyard. after learning about the role of organisms in an ecosystem, lilah compares
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!