1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
What is expected to happen to the birth rate as population density and competition increase? A. increases B. remains the same C.
barxatty [35]
I think the answer is C. Hope it helps
8 0
3 years ago
Read 2 more answers
How do I explain l my answers more clearly?
sukhopar [10]

Answer:

Organize

Explanation:

Section your thought process into bits so it is more clear.

Try to neeten your handwriting. (This requiers practice)

Hope this helps!

3 0
3 years ago
A red flowered pea crossed with a white flowered pea produces all red flowered offspring. If two of the F1 pea plants were cross
MrRissso [65]

Answer:2 red

Explanation:

4 0
4 years ago
How does a euglena identify a light source and move toward it So photosynthesis can occur
DerKrebs [107]

Answer:

Eugleas create their own food through photosnthsis, the process of absorbing sunlight to synthesize foods from carbon dioxide and water. An eyespot at the front end of the euglena detects light I belive

Explanation:

8 0
4 years ago
Temperature differences between
Galina-37 [17]
B causes all vegetation to freeze
7 0
2 years ago
Other questions:
  • Based on fossil evidence, eukaryotes evolved about _____ years ago. based on fossil evidence, eukaryotes evolved about _____ yea
    6·1 answer
  • Which of these causes adaptive radiation?
    13·1 answer
  • How would you determine if a bond if polar or nonpolar?
    15·1 answer
  • Inside each of your lungs there are tubes called bronchi. these branch into even smaller tubes much like the branches of a tree.
    11·2 answers
  • What is the role of DNA in transmitting genetic information? Describe DNA’s important genetic role in few sentences below.
    15·1 answer
  • 13. Explain why a characteristic which helps an animal to live longer will generally tend to become more
    13·1 answer
  • What virus structure is similar in function to a cell membrane?
    7·1 answer
  • The second law of thermodynamics states that
    11·2 answers
  • What happens if I recycle my plastic consumption for a week?
    14·1 answer
  • In a given year, which would result in the greatest increase in population size?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!