1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
What are the parts of phospholipid molecule?
ki77a [65]
Hydrophilic heads, hyrdophobic tails. Heads are made of phosphate and the tails are made of lipids.
8 0
3 years ago
Read 2 more answers
When two deep currents meet what happens
Leokris [45]

Grounds are located where warm and cold currents converge, where warm and cold currents meet happens to have regular foggy conditions, as the overlying warm and cold air come in contact with each other. They also tend to have high biological productivity, because plankton growth is encourage by the mixing of warm and cold currents. Some of the world's most productive fishing.

8 0
4 years ago
What characteristic makes osmosis different from diffusion?
Rom4ik [11]
The answer to the question is B
7 0
3 years ago
The second Latin word in the taxonomic binomial Rosa vulgaris indicates which category within the system?
raketka [301]

Answer:

Species

Explanation:

According to the binomial system of nomenclature, an organism has two names. The first part of the scientific name is the name of the genus followed by the name of the species. A species is a group of organisms that can interbreed to produce new fertile offspring.

3 0
3 years ago
In what way to plant to prevent erosion going to sign​
levacccp [35]

Answer: covering crops

Explanation:

such as vetch, rye and clover, are excellent plants for erosion control. These hardy easy to grow plants send out nets of roots that help hold topsoil in place while also reducing competitive weeds. When tilled back into the soil, they increase the nutrient density as they compost.

8 0
3 years ago
Other questions:
  • List the three function of an arthropod exoskeleton
    10·1 answer
  • New biosensors, applied like a temporary tattoo to the skin, can alert serious athletes that they are about to "hit the wall" an
    5·1 answer
  • In gorillas, the ability to roll the tongue is under the control of 1 gene. The R allele, which confers tongue-rolling ability,
    11·1 answer
  • Most food chains have no more than six organisms. why is there a limit to the number of links in a food chain?
    11·1 answer
  • To assess Mendel’s law of segregation using tomatoes, a true-breeding tall variety (SS) is crossed with a true-breeding short va
    13·1 answer
  • What atom contains 6 protons and electrons
    5·2 answers
  • Explain the interaction between the gravitational pull of the sun and earths inertia
    15·1 answer
  • At the end of DNA replication, each of the two new DNA molecules is composed of which of the following? *
    14·1 answer
  • What are two variables that form larger and heavier elements than hydrogen and helium in starts?
    5·2 answers
  • What part of the brain is highlighted in the diagram below?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!