1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
If a somatic human cell is just about to divide, it has __________ chromatids.
diamong [38]
If a somatic human cell is about to divide, then it has 92 chromatids. this is because there are 23 pairs of homologues chromosomes in a cell, one is given by both parents. when a cell divides my mitosis, the pairs separate into 46 chromatids, each one that is replicated which gives you 92 chromatids.
5 0
3 years ago
Identify the longitudinal section of a long bone and interior bone structure.
Savatey [412]
The long bones are those that are longer than they are wide.
They are one of five types of bones long, short, flat, irregular and sesamoid.
4 0
3 years ago
True or False: Eye Color: Blue and Brown and Freckles: Freckles or no freckles are examples of human traits that have 2 variatio
lesantik [10]

Answer:

Explanation:

True

4 0
3 years ago
Choose the magma type which is most viscous: <br> basaltic <br> andesitic<br> rhyolitic
Leviafan [203]
The third option "Rhyolitic" would be your answer.
6 0
3 years ago
Read 2 more answers
how do you living and nonliving things interact with each other? how might the function of an ecosystem be affected if living an
MrMuchimi

Answer:

Some examples of living things are organisms such as plants, animals, fungi, and bacteria. Organisms interact with the living and nonliving things in their ecosystem to survive. ... These living things interact with the nonliving things around them such as sunlight, temperature, water, and soil

7 0
3 years ago
Other questions:
  • The principal enzyme involved in dna replication is _____ because it joins individual nucleotides to produce a dna molecule.
    9·1 answer
  • When people exercise, their body cells build up more waste quickly. Which two body systems work
    11·1 answer
  • What nutrient is responsible as a chemical catalysts for body processes?
    5·2 answers
  • What does "semi-permeable" mean
    5·2 answers
  • Can you define chromatid
    6·1 answer
  • 3.
    7·2 answers
  • What will happen to the photosynthesis rate if you increase the intensity of light?
    15·2 answers
  • Which of the following statement about gene mutation is not correct. It:
    11·1 answer
  • Drag the statements that apply or do not apply to catalysts in the appropriate box.
    8·1 answer
  • Can dogs regulate their body temperature?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!