1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
The piophilidae are commonly known as ___________ flies
True [87]
Skipper flies
Your welcome
6 0
3 years ago
1. What atoms have you learned about that are involved in biomolecules? 2. How is a monomer different from a polymer?
just olya [345]

Answer:

Most biomolecules are organic compounds, and just four elements—oxygen, carbon, hydrogen, and nitrogen—make up 96% of the human body's mass. But many other elements, such as the various biometals, are present in small amounts.                   Sometimes polymers are also known as macromolecules or large-sized molecules. Usually, polymers are organic (but not necessarily). A monomer is a molecule that is able to bond in long chains.

Explanation:

Understand?

8 0
3 years ago
Which of these forces help protons and neutrons to stay at the center of the atom?
Firlakuza [10]
Can't be gravitational, due to the fact that atoms are way too small to have a gravitational pull for something of similar size.
 

The strong nuclear force is the answer you're looking for.

3 0
3 years ago
Read 2 more answers
Enzymes can be denatured unfolded by what environmental factors
erastova [34]

Enzymes can be denatured unfolded by heat or chemicals.

<h3>What are enzymes?</h3>

Enzymes are proteins that are found in living organisms which are able to increase the rate of chemical reaction and remains unchanged at the end of the reaction.

The factors that can denature enzymes include heat and chemicals. This is because:

  • Higher temperatures disrupt the shape of the active site, which will reduce its activity, or prevent it from working. When the enzyme loses its shape, it is said to have been denatured.

  • These environmental factors can alter the pH level of the enzyme.

Therefore, for an enzyme to perform its functions, the external factors that affects it's activities must be normal and favorable.

Learn more about enzymes here:

brainly.com/question/19423601

#SPJ1

3 0
2 years ago
What is an Igneous Rock?
juin [17]

Answer:

rock that forms when melted rock (magma, lava) cools and hardens

Explanation:

Igneous rock, or magmatic rock, is one of the three main rock types, the others being sedimentary and metamorphic. Igneous rock is formed through the cooling and solidification of magma or lava. The magma can be derived from partial melts of existing rocks in either a planet's mantle or crust.

Brainliest plz

8 0
3 years ago
Other questions:
  • It is often stated that the phosphate bonds in atp are "high energy," but in fact, they are not notably high in energy. rather,
    5·1 answer
  • What is the correct description of alcoholic fermentation?
    9·2 answers
  • How does a synthetic sponge mimic a live sponge to pick up dirt?
    7·2 answers
  • Often organisms seem similar in their outward appearances. For example, a porpoise and a shark seem closely related, but they ar
    8·2 answers
  • What are the difference and similarities between saprotrophs and parasities​
    12·1 answer
  • True or false? A codon is a group of three bases that can specify more than one amino acid.
    11·1 answer
  • PLEASE HELP ME! 10 POINTS+BRAINLIEST
    10·1 answer
  • Epigenetics is defined as the
    13·1 answer
  • Students observed a plant left by a window over several days. The plant was watered daily. After three days, the plant began to
    7·1 answer
  • G proteins are enzymes that bind and hydrolyze GTP to GDP. They are regulated by associated proteins that induce the binding of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!