1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
Why do the other planets take longer to orbit the Sun than the inner planets do​
Zepler [3.9K]

Answer:

Outer planets take longer to orbit than inner planets because of the greater distance they need to cover. They also are further from the sun weakening the power of the suns gravitational pull which causes then to orbit slower.

Explanation:

!!

5 0
3 years ago
Read 2 more answers
Which of the following statements is true?
Zepler [3.9K]
<span>Prokaryotic organisms are always unicellular, but eukaryotic organisms are always multicellular.
the second option because pro are usually found in plants and euk in animals and humans 
</span>
7 0
3 years ago
Read 2 more answers
Several bird species feed in a certain species of tree. each bird species feeds in a different part of the tree. which factor ar
gavmur [86]

Competition factor are the species of birds responding to in the environment. Thus, the correct option is B.

<h3>What is competition?</h3>

If numerous bird species eat on the same tree species, there will be fierce competition for food. As a result of the competition, each species will seek out a certain portion of the plant to feed on, most likely the part of the plant where it will be easiest to outcompete the competitors for food.

As a result, we may deduce that the right response is "They have evolved to diverse niches as a result of competition."

For more information regarding competition, visit:

brainly.com/question/15525466

#SPJ1

4 0
2 years ago
Phytoplankton form the base of food webs, but are only present in the upper few hundred meters of the ocean. A number of factors
Ksenya-84 [330]

Answer:

The correct answer is d. Oxygen

Explanation:

Phytoplanktons are responsible for the fixation of approximately half of the global carbon therefore seawater has high CO2 concentration which is required by phytoplanktons to make their food.  

They are the primary producers of oceans and they are responsible to support the food chain of oceans. Factors that can limit their growth are mainly sunlight and nutrients like phosphorus, nitrogen, etc.

As phytoplanktons are photosynthetic they release oxygen itself as a byproduct therefore oxygen is not a limiting factor to phytoplanktons. So the right answer is d.

6 0
3 years ago
Where does The energy come from to heat the oceans
Daniel [21]

Answer:

the sun

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why do biologists have to study chemistry?
    15·1 answer
  • The LEAST LIKELY reason for Cubans to migrate mostly to Miami since the 1960s was the A) American dream. B) better climate. C) p
    9·2 answers
  • Answer ASAP please
    15·1 answer
  • Which relationship between the two species listed would be mutually beneficial?
    5·1 answer
  • Oraciones con selva
    9·1 answer
  • What is the result of inbreeding over generations?
    14·1 answer
  • Muscle fibers differ from typical cells in that muscle fibers ______________
    14·1 answer
  • What human activity would have the most significant effect on the temperature of the earth?
    15·2 answers
  • Which of the following is correct?​
    14·2 answers
  • State 2 features each which viruses have in common with living things
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!