1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
2 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]2 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
In the plant kingdom, all the different species are descended from a single common ancestor. What is the correct term that descr
Nikitich [7]

Answer:

yes

Explanation:

lol, lol

7 0
3 years ago
The ultraviolet region of the electromagnetic spectrum extends beyond violet in the visible region. Knowing the relationship bet
Lunna [17]
As discussed in Unit 10 of The Physics Classroom Tutorial, electromagnetic waves are waves that are capable of traveling through a vacuum. Unlike mechanical waves that require a medium in order to transport their energy, electromagnetic waves are capable of transporting energy through the vacuum of outer space. Electromagnetic waves are produced by a vibrating electric charge and as such, they consist of both an electric and a magnetic component. The precise nature of such electromagnetic waves is not discussed in The Physics Classroom Tutorial. Nonetheless, there are a variety of statements that can be made about such waves.


8 0
3 years ago
Why are groups of small cells better than one large cell at moving material in
kirill [66]

The groups of small cells better than one large cell at moving material in  and out because they have a greater surface-to-volume ratio.

<u>Option: A</u>

<u>Explanation:</u>

This happened so as these smaller cells, unlike bigger cells, can quickly and willingly enter and move through the membranes of other cell membranes and permeable coverings. For these smaller and mini cells, it is also important to penetrate and move effectively, distribute and transport products and materials such as nutrients, oxygen and waste across the body without requiring enough energy and saving less space. They are cheaper, more effective and use less room for simple reasons, and most notably deplete less resources.

7 0
2 years ago
5. Which of the following is true of innate behaviors that are described as instincts?
Nataliya [291]

Answer:

instincts are complex series of innate behaviors.

5 0
2 years ago
The life cycle of a white wagtail
Kazeer [188]
The eggs begin to hatch after 12 days (sometimes as late as 16 days). Both parents feed the chicks until they fledge after between 12 and 15 days, and the chicks are fed for another week after fledging. They will then repeat what the would do having eggs with a mate and then eventually die.
3 0
3 years ago
Other questions:
  • What role does intraspecies competition play in natural selection?
    15·2 answers
  • The most common site of back pain is the __________ area. question 15 options:
    11·1 answer
  • Vsuppose that for an organism, 2n = 8. how many chromosomes do the organism's gametes contain?
    15·1 answer
  • Why we name that ATP is an energy “station” of the cell?
    10·1 answer
  • Why is oxygen important for maintaining your muscles functions
    6·1 answer
  • What is the powerhouse of the cell. i give brainliest
    14·2 answers
  • 15. The RQ is less than 1 when ......fats are
    6·1 answer
  • - Increasing the temperature in a gas in a given volume decreases temperature.
    12·1 answer
  • Marcus grew three rosemary plants. He put one in
    14·1 answer
  • Define the term developed nation
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!