1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
5

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT

-5' produces a polypeptide that joins in pairs to form a functional protein.
a) What is the amino acid sequence of the polypeptide produced from this sequence?
Biology
1 answer:
alexandr402 [8]3 years ago
4 0

Answer:

Met-his-Pro-Ile-ala-Ser-ala-asp

Explanation:

The protein molecules are synthesized from the mRNA molecule synthesized from the DNA by the transcription. The translation process then translates the mRNA to the amino acids which then join together and form the proteins.

In the given question, the template strand of the DNA is provided is

Template DNA- 3'- TAC-GTA-GGC-TAA-CGG-AGT-AAG-CTA-ACT -5

 mRNA- 5'-AUG-CAU-CCG-AUU-GCC-UCA-UUC-GAU-UGA-3'

 Protein-      Met-his-Pro-Ile-ala-Ser-ala-asp-stop codon

The translation process begins when the tRNA molecule recognizes the AUG or start codon and then reads the nucleotide in the triplets. Each triplet code for the specific amino acid.On the basis of this, amino acid chain is constructed.

Thus, Met-his-Pro-Ile-ala-Ser-ala-asp is correct.

You might be interested in
What caused the massive erosion of the
pochemuha

Answer:

A Reduced sea turtle population due to monofilament nets

Explanation:

Hope this helped you

7 0
3 years ago
Read 2 more answers
Which process is demonstrated by the image below? *
saul85 [17]

Answer:

Transpiration would be the right answer!

Explanation:

Above we see exhalation of water and plant loose 90% of its water through Transpiration.

hope it helps

3 0
3 years ago
Read 2 more answers
A radiation event would appear as an area with little branching on a phylogenetic tree.
Arada [10]
False; a radiation even should lead to many branches (many new species).
4 0
4 years ago
Based on your experiences, state a hypothesis about which of the following five areas of the body - fingertip, forearm, back of
lianna [129]

fingertip, back of neck, back of hand palm, forearm

Just guessing

7 0
4 years ago
Read 2 more answers
When an endogenous ligand like dopamine travels further away from the synapse to affect the activity at another synapse, we call
irga5000 [103]

Given what we know, we can confirm that this behavior is indicative of a neurotransmitter.

<h3>What are neurotransmitters?</h3>

A neurotransmitter is a signal liberated by a neuron, to describe it in the most simple of terms possible. This neurotransmitter travels further from the originating synapses and affects another cell, being involved in the new synapse taking place in that cell.

Therefore, we can confirm that this behavior is indicative of a neurotransmitter.

To learn more about neurotransmitters visit:

brainly.com/question/8849920?referrer=searchResults

8 0
2 years ago
Other questions:
  • Twin studies have confirmed that genetic and environmental factors operate __________ to guide development.
    10·1 answer
  • What evidence supports the assumption that a large number of living species disappeared about 65 million years ago due to a cata
    15·1 answer
  • Children 13 years and older continue to build their vocabulary with an emphasis more on ____ than on _____
    7·1 answer
  • Scientists agree that the term biodiversity describes the number and kinds of species in a location on Earth. Scientists have al
    14·2 answers
  • the scientific method is limited to investigating physical phenomena that are which of the following? select all that apply.
    6·1 answer
  • What does the word “corona” mean? How does this relate to the ability of the virus to adhere to other cells?
    12·1 answer
  • Organisms in which a circulating body fluid is distinct from the fluid that directly surrounds the bodyʹs cells are likely to ha
    9·1 answer
  • Help i dont know the answer
    14·2 answers
  • How do mountains play a role in precipitation patterns like ?
    12·1 answer
  • (In 4 to 5 sentences explain the movement though the flow chart in ur own words.)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!