1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
11

Drawing of a molecule

Biology
2 answers:
liraira [26]3 years ago
7 0

Answer:

Which Molecule do you need?

Julli [10]3 years ago
7 0
What molecule do you need?
You might be interested in
Five significance of genetic engineer​
Ahat [919]

Answer:

This is your answer

4 0
3 years ago
_____ have a pseudocoelom and are the simplest animals that have a complete digestive tract.
alex41 [277]

Nematodes have a pseudocoelom and are the simplest animals that have a complete digestive tract.

Nematodes also known as roundworms are animals well adapted to variety of environments, meaning that are ubiquitous. Nematodes are small, bilaterally symmetric with ornamented ring body structures. Their body is covered with cuticle that works with the muscles beneath it to create a hydroskeleton. There are free-living species and parasitic species of Nematoda.  

8 0
3 years ago
In pea plants, tallness (T) is dominant to shortness (t). What is the predicted genotypic ratio of the offspring if a homozygous
Jlenok [28]
Hope this helped! This is called a punnett square, it calculates the percentages of phenotype outcomes. Some are more difficult than others, but this is pretty basic, just be sure to study about this.

7 0
3 years ago
When people run quickly, they can sweat profusely. Their muscles undergo movement, and the loss of energy takes place. Based on
andreev551 [17]

So, first question:

When we run, we sweat, which means we're getting hotter and hotter and our bodies need to cool down, which they do through transpiration (sweating). If we need to cool down, we need to release the heat that is in our bodies.

To run, we also need to move our muscles, which requires a specific type of energy, called mechanical or kinetic energy, which is the "energy of movement". In our bodies, we don't store that type of energy though, so we have to convert chemical energy to mechanical energy.

Answers: First option and third option.

Second question:

We know that to move we need energy, and that an amazing source of energy is sugar. In this case, the biomolecule mainly used by cells to obtain energy, is glucose, which is a type of sugar.

Answer: B.

Third question:

NAD+ stands for Nicotinamide adenine dinucleotide +, an it has many functions, such as an oxidiser. In this case, in fermentation, it's related to glycolysis.

Glycolysis is a process of energy transformation used by cells, where they convert sugars to biochemical energy. The function of NAD in this case, is "housing" electrons for the process to function normally. Note that during the process, when NAD accepts electrons, it gains 1 proton which converts it to NADH.

Answer: C.

Hope it helped,

BioTeacher101

4 0
3 years ago
Read 2 more answers
Which of the following statements is true about the scientific process?
sleet_krkn [62]
"The hypothesis is always supported in the end" is the one statement among the following that <span>is true about the scientific process. The correct option among all the options that are given in the question is the first option. I hope that this is the answer that has actually come to your help.</span>
3 0
3 years ago
Other questions:
  • What is one benifit to humans we get from burning fossil fuels ?
    10·1 answer
  • This property of water helps make it the universal solvent?<br><br><br> solvency or polarity?
    7·2 answers
  • Explain how valves help the transport of blood in veins.
    9·1 answer
  • What is the cause of the striated appearance of skeletal and cardiac muscle?
    12·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Complex nutrients are digested and then absorbed into the bloodstream as
    14·1 answer
  • Gene therapy, which includes the correction of defective genes, is a significant part of the human genome project. Which of thes
    7·2 answers
  • Please help me please help<br>​
    10·1 answer
  • Can someone please help me? :(
    6·1 answer
  • My Octopus Teacher <br> How does the filmmaker know when trust is obtained with the octopus?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!