1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
5

Reviewing Mendel's Pea Plant QUICK CHECK Gregor Mendel studied pea plants to determine the patterns of inheritance. What is not

a reason Mendel used pea plants in his experiments? Check all that apply. They reproduced sexually. They were drought resistant. They had traits that were easy to observe. They only had two traits to study. DONE​
Biology
1 answer:
Natalka [10]3 years ago
7 0

Answer:

Drought resistant and Only had two traits to study

Explanation:

You might be interested in
What structural level of proteins is most often associated with their biological function?
dem82 [27]

Answer:

I think primary function

6 0
3 years ago
A multi-stage experiment was conducted with two different species: a nonpathogenic strain of Buttiauxella agrestis (Ba) and a st
denis23 [38]

Answer:

Transduction

Explanation:

Transduction can be explained or described as the process through which foreign DNA is introduced into a cell by a virus or viral vectors.

It should be understood that initial Ba cells were not pathogenic or virulent, but the Ba cells becomes virulent when the DNA of the Hi/pvir was introduced into them during the incubation period. This process is what is known as transduction.

3 0
3 years ago
Which organisms contain Nucleic Acids? Check all that apply.
bixtya [17]
Bacteria containing nucleic acids
6 0
3 years ago
Read 2 more answers
How is population defined in ecology?
ycow [4]
<h2> <u>☸</u><u>ANSWER</u><u>☸</u><u>.</u><u> </u></h2>

In genetics a population is a group of interbreeding individuals of the same species, which is isolated from other groups. In population ecology a population is a group of individuals of the same species inhabiting the same area.

<h2><em><u>Hope</u></em><em><u> </u></em><em><u>it</u></em><em><u> </u></em><em><u>helps</u></em><em><u> </u></em><em><u>you</u></em><em><u>✨</u></em><em><u>.</u></em><em><u> </u></em></h2>

<em><u>Thanks</u></em><em><u>❤</u></em><em><u>.</u></em>

5 0
3 years ago
A group of the same type of organisms
lesya692 [45]

Answer:

A species? You included it in your question.

4 0
4 years ago
Other questions:
  • Two males weigh 195 pounds and are 45 years old. one has a body fat percentage of 13% and the other's body fat percentage is 29%
    14·1 answer
  • 2) We wish to test if a certain vaccine developed for a disease is effective or
    5·1 answer
  • 20)
    9·2 answers
  • The _____ system includes the esophagus. digestive circulatory respiratory skeletal
    9·2 answers
  • The marketing environment is best described as being a. slow, with infrequent fluctuations. b. composed of variables independent
    14·1 answer
  • During fetal development, cells from the blood can enter a membranous area that will become the frontal bone. These cells eventu
    5·1 answer
  • How do we get pineapples? How do you grow them? Do they come from trees??
    14·2 answers
  • Use the drop-down menus to complete the hypothesis of the first group of researchers. During a drought, the decrease in rainfall
    8·1 answer
  • A mutation was found in which the DNA sequence changed from 5' CCCGGGAGA 3' to
    5·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!