1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
5

Please help !!

Geography
1 answer:
Maru [420]3 years ago
4 0

Answer:

average flow

Explanation:

You might be interested in
which features are often formed by orogenic events? 1. foreland basins 2. mountain ranged 3. nappes 4. sediments
Gnesinka [82]

Answer:

2. Mountain Ranged

Explanation:

Orogeny is the primary mechanism by which mountains are formed on continents. An orogeny is an event that takes place at a convergent plate margin when plate motion compresses the margin. This leads to both structural deformation and compositional differentiation of the Earth's lithosphere.

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Where is the Pacific Ocean located?
Setler79 [48]

i think the answer would be "in both eastern and western hemispheres"

4 0
4 years ago
Read 2 more answers
A weather system is moving from west to east. you look at a weather map and see that you are in an area of closely spaced isobar
katrin2010 [14]
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions here.

Below are the choices that should be accompanied with your question:

A) Winds will increase.
B) Winds will increase then decrease.
C) Winds will stay the same.
<span>D) Winds will decrease.
</span> 
The answer is A - Winds will increase. Isobars<span> are lines on a weather map that connect points of equal pressure.</span>
4 0
4 years ago
Read 2 more answers
when organisms die, how does carbon re-enter the environment? i. carbon dioxide (co2) is released during decay ii. carbon monoxi
snow_lady [41]

Answer

When the Organism dies, while the body becomes part of the soil(Decomposition), there is still Carbon that is trapped in the organism, so eat time something new from the body gets exposed, Carbon is released.

Explanation:

There are pockets that are in your body that hold air, and when we die, and those areas that are holding the air pockets become exposed while the decomposition, the Carbon gets released out of the body and into the air.

8 0
2 years ago
Other questions:
  • How the negative impacts of global warming on seas and oceans can be avoided.
    14·1 answer
  • Which density measure differs most between Egypt and Ethiopia? What might account for this difference?
    6·1 answer
  • Which continents include locations that have east longitude in their address?
    12·1 answer
  • Join my fun kahoot pin 2826556
    6·1 answer
  • Observations of distant quasars indicates that the universe contains _____ dark matter.
    13·1 answer
  • Easy Question plz help
    6·2 answers
  • What geologic factors contribute to California's natural resources?
    12·1 answer
  • Do you think there is a way to record history without bias?
    5·2 answers
  • Which map balances area and shape distortion, resulting in a fairly accurate picture of the world?
    10·1 answer
  • Which of the following is the most likely global climate change?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!