1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
2 years ago
9

Matt is an athlete, but recently he's been feeling sluggish during practice. He needs to take more breaks because he feels tired

. His doctor tells him that an organelle in his cells isn't working as it should. Which organelle is most likely the cause od Matt symptoms
Biology
1 answer:
Zanzabum2 years ago
7 0

the brain is the answer

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Calories in food are related to calories in physics because
nevsk [136]

I think that they both measure energy

7 0
3 years ago
Read 2 more answers
A frameshift mutation that occurs very early in a protein sequence would have what effect on the protein's structure? see sectio
ExtremeBDS [4]
I think a frameshift mutation that occurs very early in a protein sequence would have an effect on the structure of the protein such that the primary, secondary, and tertiary structures would be altered. A frameshift mutation occurs when a protein is drastically altered because of an insertion or a deletion. Insertions and deletions cause a change in the length of a gene, which causes a shift in the codon reading frame. 
7 0
3 years ago
Marfan syndrome is a dominant trait. A cross between a homozygous dominant and a heterozygote would produce what phenotypic rati
umka2103 [35]

Answer:

The correct answer is- 4:0

Explanation:

Marfan syndrome is a genetic problem which affects the connective tissue in the body. The trait for this disease is autosomal dominant which means even one abnormal copy of this gene in the offspring or individual is sufficient to cause this syndrome.

Let S is the allele that is dominant for this syndrome and s is recessive. So if a cross between homozygous dominant(SS) and heterozygous individual (Ss) occurs than all the offspring would have this syndrome.  

                                   S      s

                              S  SS   Ss

                              S  SS   Ss

Therefore all 4 offspring would have at least one dominant allele which is sufficient to cause this syndrome. So the phenotype ratio would be 4:0.

                       

3 0
3 years ago
During a long-distance run on a hot day, an athlete produces large quantities of sweat. As a result, the kidneys change the rate
Anton [14]

Answer:

To regulate water balance in the body

Explanation:

The kidneys are two bean shaped renal organs which perform a host of functions for the body such as regulating fluid balance, filtering minerals from the blood etc. Among their functions is the regulation of water balance in the body through the antidiuretic hormone.

When an athlete completes a physical activity and sweats a lot, the kidney reacts to the loss of water by sweat by adjusting urine output causing the body to produce lower and more concentrated urine.

5 0
2 years ago
Other questions:
  • explain what typically marks the beginning and end of any division of time on the geologic time scale?
    7·1 answer
  • At each stage of the trophic levels, how much energy is lost?
    6·1 answer
  • What are red eared slider turtles predators
    13·1 answer
  • _______ power can be harnessed in the ocean to create power.
    8·2 answers
  • When a tautomeric shift occurs, the resulting nulceotide is a(n) __________ of the nucleotide prior to the shift?
    11·1 answer
  • Which ocean has the largest number of islands?
    15·2 answers
  • Why does a cracker taste different after being soaked in saliva for 2 minutes?
    7·2 answers
  • Which of the following does not affect the gravitational force between the earth and the sun?
    15·2 answers
  • List some examples of how populations affect each other.
    5·1 answer
  • Please help
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!