1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
6

Mr Zulu consumes 75 litre of diesel per month average and Mrs Zulu consumes 58 litre of petrol per month on avage

Geography
1 answer:
NemiM [27]3 years ago
5 0

Answer:

Mr.Zulu needs to get a life

Explanation:

You might be interested in
6. The Yucatán peninsula is a _ region.
Alik [6]

Answer:

its a Mexican region

Explanation:

3 0
3 years ago
Select the statements that describe aspects of resources. The availability of resources influences where people live. Renewable
Kruka [31]

The answers are:

The availability of resources influences where people live.

The employment of energy is the greatest use of the world's resources.

Recognizing the need to conserve oil resources, many nations are seeking alternative energy sources.

Hope this helps.

4 0
3 years ago
Read 2 more answers
How are decisions about what to produce made in australia
mylen [45]
The answer is D. 
free-enterprise system<span>economic system in which individuals own the factors of production and decide how to use them within legal limits; consumers make decisions about what should be produced</span>
3 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which of these is one of two major rivers that feed into the aral seas?
melisa1 [442]

Answer:

Correct answer is A. Amu Darya.

Explanation:

A is correct as Amu Darya flows into Aral Sea, that is located in Uzbekistan.

B is not correct as the Yellow River flows into Bohai Sea .

C is not correct as Danube flows into Black Sea.

D is not correct as the Volga River flows into Caspian Sea.

6 0
3 years ago
Other questions:
  • Characters who do not change during the course of a story are __________.
    13·1 answer
  • What is an enclosed body of coastal water that is a mixture of salt water and freshwater called?
    10·2 answers
  • What volcanoe is in the middle of a continent
    8·1 answer
  • There are many kinds of in the north america
    15·1 answer
  • Ocean currents and global wind patterns, which are caused by convection currents, most strongly affect a region's A. population
    11·2 answers
  • Physical weathering may happen because of temperature change if the temperature rises the minerals in rock may ______ and cause
    14·1 answer
  • Who is the president of Nigeria​
    14·2 answers
  • The treatment of intellectuals under the rule of the khmer rouge, of the jews in europe during world war ii, and of the armenian
    14·1 answer
  • -12(4n + 65) = 36 njbbn
    10·1 answer
  • Uno de los hechos con los que se relaciona el surgimiento de las civilizaciones antiguas es:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!