1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lyudmila [28]
3 years ago
14

Which of the following is NOT a reason why cells reproduce asexually?

Biology
1 answer:
sergejj [24]3 years ago
6 0
Wheres the following lol
You might be interested in
True or false? When sulfur and nitrogen oxides mix with water in the air they form photochemical smog
kotykmax [81]
The answer you are looking for is True
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
I WILL GIVE BRAINLIEST!!!
adelina 88 [10]

by the law of natural selection, daddy charles darwin stated that overpopulation could result in famine and wars, and death would accelerates across nations, so overpopulation is a cause for this because of too many organisms but not enough food, which declined growth rate.

5 0
2 years ago
Read 2 more answers
Darwin hypothesized that new species could appear gradually through small changes in an ancestral species.what experiment did he
Elanso [62]
Answer;
He conducted an experiment with breeding pigeons. 

Explanation;
The pigeons provided the perfect animal to test his theory of selection for quite a number of reasons including its trait diversity from wing structures to color patterns to size to flight patterns. From these experiments he concluded that by natural selection of randomly occurring traits that make species better suited for survival and reproduction, evolve in the astounding diversity of organisms on Earth today. 
6 0
3 years ago
Read 2 more answers
As the temperature increases the solubility of most compounds also increases. The rate of reaction _________ as the concentratio
Tamiku [17]

i think it is D) stays the same, decreases.  because it sound right to me.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why are formation and decay considered a cycle of nature?
    12·1 answer
  • Which method of classification requires that each taxonomic group be monophyletic
    6·1 answer
  • The EMT is determining total body surface area involved due to severe​ full-thickness burns to a large portion of the body in an
    8·1 answer
  • Plants, people, and flatworms share a common characteristic. Identify that characteristics from the choices blow.
    8·2 answers
  • The dew point is reached when___.
    10·1 answer
  • Cheetahs survived an event that brought them close to extinction. The few survivors repopulated the earth with the cheetahs we h
    12·2 answers
  • Describe the three stages of cellular respiration and identify the part of the cell in which cach
    10·1 answer
  • What types of erosion help create V-shaped valleys?
    11·1 answer
  • She doesn't know the whole course because she was absent the day we were learning this so, she needs more help!! (My friend)
    15·1 answer
  • Plzzzzzzzz help............<br><br><br><br><br>​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!