1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
12

Define chemical properties and give 3 examples.

Geography
2 answers:
mylen [45]3 years ago
6 0

Answer:

The change of one type of matter into another type (or the inability to change) is a chemical property. Examples of chemical properties include flammability, toxicity, acidity, reactivity (many types), and heat of combustion.

hope this helps :)

almond37 [142]3 years ago
5 0

Answer:

A chemical property is any of a material's properties that becomes evident during, or after, a chemical reaction; that is, any quality that can be established only by changing a substance's chemical identity.

Explanation:

Examples of chemical properties include flammability, reactivity (many types), and heat of combustion.

(Hope this helps :D)

Love you all! Stay Safe out there!  Dont forget to wear a mask!

You might be interested in
What factors threaten Eastern Europe's marine ecosystem? select all that apply. farming forestry industry tourism transportation
WARRIOR [948]

One is definitely tourism.

Explanation:

The factor that jeopardizes the ecosystem in Eastern Europe is the tourism industry. Individuals simply travel there and have a fabulous time yet they don't pay attention and leave beaches dirty. They are not dealing with nature and the administrations can't do much since sightseers leave a lot of money for the nations.

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
When stretched out maine has a longer coastline than what state?
valina [46]
I think its California let me know if this is correct

5 0
3 years ago
Which of the following statements best describes the Sepoy Rebellion? A. Indians rebelled against British colonial rule in 1857.
Ostrovityanka [42]

Answer:

The answer is A.

Explanation:

4 0
2 years ago
Read 2 more answers
What is the main form of tetonic plates??
Igoryamba
African
Antarctic
Eurasian
Australian
North America
Pacific
South America
Hope this is right....
7 0
3 years ago
Other questions:
  • The process by which sheets of rock peel away from a large body of rock when pressure is removed ?
    11·1 answer
  • Describe the differences in an oceanic and continental crust.
    5·1 answer
  • A civilization on a vast, open plain with rich resources is likely to be:
    11·1 answer
  • The spectrum of galaxy A and galaxy B both contain the H-alpha emission line, which is normally seen at 653nm. However, in galax
    11·1 answer
  • If you are traveling from north to south at 9:00am on a sunny morning, which side of the vehicle will the sun be shining on? The
    10·2 answers
  • Galaxies that are closer to Earth appear to be _____ Earth.
    12·1 answer
  • What is the difference between an ocean and a sea? What is the difference between an ocean and a sea? An ocean is a vast body of
    8·1 answer
  • Why did the Israelites leave Egypt
    6·1 answer
  • What is the largest mountain range in south america
    5·1 answer
  • Look at the diagram. Which of the following is most likely found at the area
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!