1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
2 years ago
6

Severe weather events can create ecological disturbances, which can impact biodiversity. Think about a severe weather situation

you have experienced near your home or have witnessed on the news. In 3–5 sentences, explain how the severe weather event created ecological disturbances that impacted biodiversity.
Biology
2 answers:
miv72 [106K]2 years ago
6 0

Answer:

"Or Have Witnessed On The News" Hurricane Katrina was a weather event, that created huge ecological disturbances. The hurricane caused damage to 5 million acres of land, which included coastal forests where many animals called home. The storm killed thousands of humans and animals, and also sent potential invasive species to new environments.  The hurricane caused 10 coastal bird species to decline, the storm also caused disturbances in the aquatic wildlife with over 9 million fish being killed offshore due to the hurricane, the dolphins were also heavily impacted with many being injured in the storm, but most were rescued. The hurricane also caused freshwater overflood, it sent massive amounts of freshwater into coastal bays and estuaries which shifted the balance between salt water and fresh water.

Explanation:

My answer, i'd advise you to re-word it to advoid plagirism. For Biodeverisity Unit Test Essay Question

Ne4ueva [31]2 years ago
3 0

Read the question fully.

Think about a severe weather situation you have experienced near your home or have witnessed on the news.

The question is asking you to tell about any severe weather that you have seen, heard, or you've experienced about and just tell them about it.

You might be interested in
Which of the following best describes the hydrolysis of carbohydrates? a.The removal of a water molecule breaks bonds between su
In-s [12.5K]

Answer:

c.The addition of a water molecule breaks a bond between sugar mono-mers.

Explanation:

Hydrolysis refers to reaction with water. When water molecules are added to carbohydrates, the bonds between the sugar monomers are broken. This is the chemical reaction known as hydrolysis reaction.

Generally, since carbohydrates are polymers we can say that hydrolysis reactions result in the breakdown of carbohydrate polymers into sugar monomers by using water molecules

5 0
3 years ago
7.
yulyashka [42]

Answer:

27.5

Explanation:

Divide 75 by 6. You get 12.5. Multiply 12.5 by 2.2 (when converting kilo to pound, you multiply by 2.2) Then, you'll get 27.5. The answer is 27.5 pounds/lbs.

6 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Cell membranes are made up of a phospholipid bilayer. Which part of the phospholipid bilayer interacts with water, and which par
ki77a [65]
The part of the phospholipid bilayer that interacts with water would be the hydrophilic portion consisting of the polar phosphate group. The hydrophobic tails which are the fatty acid chains will not interact with the water present in the aqueous environment.
5 0
3 years ago
Read 2 more answers
Average atomic mass of strontium
djyliett [7]
Average atomic mass is 87.62 +- 0.01 u
6 0
3 years ago
Other questions:
  • Researchers conducted an experiment to identify the effects of three different hand sanitizers on the growth of bacteria. The re
    10·1 answer
  • All connective tissue is formed from which embryonic germ layer?
    9·1 answer
  • Define the word (Binomial name)
    6·1 answer
  • What is the function of glucose in the human body
    12·1 answer
  • Write down the names of various endocrine glands with their secretion and function.
    14·1 answer
  • Wisdom teeth are the third and final set of human molars that come in during the late teens or early twenties. In some cases, th
    15·2 answers
  • While researchers have discovered that there are an excessive number of receptor sites for _________________
    7·1 answer
  • Red blood cells are placed in a hypotonic solution.
    5·1 answer
  • HELP PLSSSSS PLS PLS PLS
    6·1 answer
  • The word root infect means which of the following?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!