1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
2 years ago
10

Which of the following statements about active transport is true?

Biology
1 answer:
Roman55 [17]2 years ago
6 0

Answer:

It results in a higher concentration of molecules on one side of the membrane.

Explanation:

Active transport is the transport of molecules up the concentration gradient. This means that molecules are going from low density to high density. This is the opposite of natural diffusion. So, it requires ATP to move the molecules this way. Diffusion normally occurs to maintain homeostasis and an equal amount of concentration on both sides of a membrane. But, with active transport, since molecules are moving up the gradient, the opposite happens and the concentrations are unequal.

You might be interested in
Which of the following is NOT a major connective tissue. loose, fibrous, tight, none of thee above
wariber [46]

a major connective tissue. loose, fibrous, tight is the answer is synovial membrane

7 0
3 years ago
Consider the pH range of various solutions. How many of the solutions were in the basic range on the pH scale?
stira [4]
I’m pretty sure it’s zeroooooooo
8 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which creature cannot survive in the presence of oxygen? Give Examples. What does the creature need to survive instead of oxygen
yan [13]

Answer:

Instead of oxygen a creature would also need nutrients. Simple everyday things like water and food.

Explanation:

Although it is kind of impossible to live without oxygen. There are organisms on the earth who do not need it and can survive. They metabolize hydrogen or methane or a number of other compounds.

3 0
3 years ago
What type of reaction occurs when chlorophyll breaks down into new substances?
malfutka [58]
Decomposition reaction occurs when chlorophyll breaks down to form new substances.
3 0
3 years ago
Other questions:
  • A spindle fiber is a specialized form of
    14·1 answer
  • Two species of garter snakes live in the same geographic area. One lives mainly in water and the other mainly on land; therefore
    11·1 answer
  • Viruses that replicate using the lysogenic cycle....
    14·1 answer
  • A producer gets energy from
    8·1 answer
  • Definition of invasive species ?
    14·2 answers
  • What is the energy source which runs the electron transport chain?
    9·1 answer
  • 1.______ from the sun is transferred to_____ surface. some of that energy is then _____
    5·1 answer
  • The breathing rate of an aquatic animal is more than that of of a terrestrial animal . Why ?​
    15·2 answers
  • 70 points! Earthquakes are the result of movement of the Earth's crust along fault lines both within and along tectonic plate bo
    6·1 answer
  • Which argument supports the idea that viruses are alive?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!