1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
12

The carbon fixation reaction converts?​

Biology
1 answer:
Anna71 [15]3 years ago
6 0

Answer:

this process involves carbon (iv)oxide with hydrogen atoms which combine to form a simple sugar

You might be interested in
In the system used to classify all organisms, which of the following is true?
Fofino [41]
B is correct, Organisms in the same group have similar characteristics
4 0
3 years ago
What is an autonomous vehicle?
Elden [556K]

An autonomous car is a vehicle capable of sensing its environment and operating without human involvement. A human passenger is not required to take control of the vehicle at any time, nor is a human passenger required to be present in the vehicle at all. An autonomous car can go anywhere a traditional car goes and do everything that an experienced human driver does.

8 0
3 years ago
Read 2 more answers
How did early eukaryotic cells benefit from the aerobic bacteria that took up residence within them? the aerobic bacteria helped
Crank

If your choices are the following, then the correct answer is C:

a. The aerobic bacteria were able to capture the sunlight and generate sugars from it.

b. The aerobic bacteria helped protect the cell against desiccation.

c. The aerobic bacteria metabolized sugars and generated large amounts of ATP.

d. The aerobic bacteria helped protect the cell against predation.

This is actually the endosymbiotic theory of how we humans (and other organisms alike) have evolved to have mitochondria inside our cells. Evidence to support this is that mitochondria have their own DNA different from ours.

<em>A</em> can't be the answer because that is more related to plants. <em>B and C </em>are also wrong because they simply do not provide those functions.

7 0
3 years ago
Read 2 more answers
Something that makes reactions start more easily and increase how fast the reaction occurs
soldi70 [24.7K]
That would be catalysts.

Catalysts accelerate (speed up) chemical reactions without damaging itself. They do this by decreasing the activation energy of a chemical reaction.

Enzymes are a type of catalysts.

3 0
3 years ago
Which type of lipid is most important in biological membranes?
Andreas93 [3]
Phospholipids is the answer
3 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Match each moon or planet to the most accurate characteristic.
    8·1 answer
  • One pack of cigarettes can reduce a person's life by __ hours
    5·1 answer
  • Match each light behavior with its definition.
    8·1 answer
  • Cells of multicellular organism are specialized due to
    13·1 answer
  • The organism shown is a free-living one that is anchored to the bottom of ponds and streams during the first part of its life cy
    9·2 answers
  • A star's illumination is possible because of _____.
    11·1 answer
  • What term describes the normal genes that are inserted into an individual's diseased cells in gene therapy? Describe three ways
    15·1 answer
  • Different between plant and animal cell​
    14·2 answers
  • You were with your younger cousin playing at the park and he has mixed up his legos in the sand.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!