1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
3 years ago
10

BRAINLIEST!!!!! PLEASE HELP ASAP!!!!!! ANSWER THIS ONLY ONE MCQ AND I AM GIVING 13 POINTS FOR IT.!!!!​

Biology
1 answer:
notsponge [240]3 years ago
7 0

Explanation:

Receptors = Sensory neurons

Relay = Relay neurons

Effectors = Motor neurons

Cell bodies of sensory neurons are only found in the root ganglion. (F)

Cell bodies of relay neurons are only found is the grey matter of the spinal cord. (G)

Cell bodies of motor neurons are also found at G.

Hence the answer is Option D.

You might be interested in
1. How does our ecological footprint affect each of the spheres on Earth?
Viefleur [7K]
Lithosphere (or geosphere) describes all the rocks, minerals and molten magma found on or in the Earth

The hydrosphere describes all the water on Earth – including liquid water (oceans, etc.) and vapour (precipitation)

The atmosphere describes the layer of gases surrounding the Earth and is divided into sections (stratosphere, etc.)

The biosphere is composed of all the living organisms on the planet (including plants, animals, bacteria, etc.)


The four spheres are interconnected, so human impact on one sphere will potentially effect other spheres

The release of plastic pollution into the oceans (hydrosphere) will impact on marine life (biosphere)

The production and release of CFCs into the atmosphere will effect the impact of UV radiation on the biosphere


The Four Earth Spheres



5 0
3 years ago
What’s the answer to this sentence ? Thx!
Nastasia [14]
Before cells could be seen by using a microscope, people believed that diseases were caused by spiritual effects.
7 0
3 years ago
Read 2 more answers
(50 points)
yulyashka [42]
We need the label and location of the image lol
8 0
3 years ago
Read 2 more answers
Which do seeds NOT need for germination?<br> A Heat<br> B Light<br> C Water<br> D Nutrients
Nimfa-mama [501]

Answer: Option D nutrients

Explanation: at the onset of germination, nutrients is not needed for seed germination. A viable seed has all it it inside of it to grow. For seeds to grow in any environment, they need water, light in some cases, depth of seed planted,temperature in some cases, and oxygen. It is later in it's growth mostly one or 2 weeks that the plant start needing nutrient. Some food crops like vegetables needs nutrients mostly immediately or a day after germination has already occued.

6 0
4 years ago
Necesitouna conclusion sobre la microbiologia y bacteriologia me ayudan pliss
Vitek1552 [10]

Answer:

.

Explanation:

.uehwbgsbabwh hsbsbs

7 0
3 years ago
Other questions:
  • What gives plant cell walls their rigidity?
    11·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Intracellular condensates are non-membrane bound biochemical subcompartments that form due to phase separation among networks of
    15·1 answer
  • A hernia in the groin area is called a/an
    10·1 answer
  • Easy 10 points , just match up the vocab.
    15·1 answer
  • Which phrase describes this plate boundary<br>​
    9·1 answer
  • Minerals required by the body in moderate amounts include all but which of the following?
    5·1 answer
  • The portion of a muzzleloader rifle that fits against your shoulder is the
    9·1 answer
  • What is the result of homeostasis at the cellular level? *
    14·2 answers
  • The pathway between the ventral tegmental area (VTA) and the _____ is critical for the addiction process because lesions to this
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!