1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natali 33 [55]
3 years ago
5

Mitochondria and chloroplastsare two types of what

Biology
1 answer:
KengaRu [80]3 years ago
5 0
Two types of organelles that produce energy
You might be interested in
how does the random alignment of homologous chromosomes contribute to genetic variation in a population
SCORPION-xisa [38]

The assortment of homologous chromosomes during meiosis is random and generates genetic variation, the raw material for evolution.

During metaphase I of meiosis, homologous chromosomes are lined up at the equator plate of the cell in order to be separated (assorted) in anaphase I.

The separation of homologous chromosomes during meiosis I is random. Daughter cells receive unique gene combinations from an original parent cell.

Subsequently, haploid cells got from two successive meiotic divisions fuse during fecundation to form a diploid (2n) zygote.

During prophase I, non-sister chromatids interchange genetic material by a process known as recombination. This genetic process also increases genetic variation in daughter cells.

In conclusion, the assortment of homologous chromosomes during meiosis is random and generates genetic variation.

8 0
2 years ago
Specialized cells are found only in
SashulF [63]

Answer: O many celled organisms

Explanation:

3 0
3 years ago
What should be your response as you approach a roundabout?
BigorU [14]
<span>The correct answer is B) choose the correct lane. It is always important when driving to ensure you are in the correct lane, but in roundabouts, it is essential to the traffic flow. Choice A is not correct because roundabouts are designed to slow down traffic and you need to be paying attention to what is going on and slowing down before you enter. Choice C is not correct because you do not have the right-of-way; the traffic already in the roundabout does and you would need to yield to them. Choice D is not correct because choices A and C are not correct.</span>
7 0
3 years ago
What sorts of organs and tissues do bacteria have ?
12345 [234]

Answer:

: todas las bacterias se pueden clasificar en una de las tres formas básicas: esferas (cocos), bastones (bacilos) y espirales o hélices (espiroquetas). Necesidad de oxígeno: las bacterias también se clasifican en dos grupos, según si necesitan oxígeno para vivir.

explicacion:

:-t          

7 0
2 years ago
How is the small intestine adapted for the absorption of nutrients?
Gelneren [198K]
The small intestine has cilia to absorb nutrients and reabsorb water
6 0
2 years ago
Other questions:
  • What happens if an atom gains 2 electrons to fill its valence shell
    12·1 answer
  • The four major functions of hormones are?
    9·1 answer
  • Frogs have developed some adaptations to survive in their environment. Match the adaptations to the benefits.
    15·2 answers
  • A DNA sample is anyalyzed and you find that 22% is cytosine. How much thymine would be in the same cell?
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • If you have a hamster with long fur, what possible genotypes could the hamster have?
    12·1 answer
  • How were sucrose and cellulose formed
    9·1 answer
  • Helppp!!! ASAP please,
    13·1 answer
  • Which model would you use to examine the relationship between nitrogen concentration and plant growth
    9·1 answer
  • Storm winds knock down trees in part of a forest. Which of these effects of
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!