A. Shellfish will disappear first if an estuary was destroyed.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
They have to have a higher density than water to have the ability to stay on the sea floor. Otherwise they would just float to the surface of the water
Sorry the photo isn't clear