1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
12

Why is forcing the cell to increase the rate of the cell cycle lead to error in DNA replication

Biology
1 answer:
IRISSAK [1]3 years ago
4 0
We tend to think of the process of DNA replication as this well laid out stoic process like a factory line. It isn't. The DNA doesn't lie in a straight line for the DNA polymerase to read and it is moving - not static. It is tangled and curved. First understand this is the molecular level. Things don't "think", bacteria don't make decisions, they have no neurons. Everything is a chemical reaction that very often depends on osmotic pressure of one concentration being stronger then another both inside of the cell and outside. Nothing is empty though even at that level there is a lot of "nothing".
You might be interested in
Which of the following will disapear first if an estuary was destroyed
e-lub [12.9K]

A. Shellfish will disappear first if an estuary was destroyed.

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Why are shell of marine snails heavier than garden snails?
const2013 [10]
They have to have a higher density than water to have the ability to stay on the sea floor. Otherwise they would just float to the surface of the water
6 0
3 years ago
Awnser this quetion<br>please
irinina [24]
Sorry the photo isn't clear
8 0
4 years ago
Read 2 more answers
The enzyme catalase is important to many organisms. This enzyme convertshydrogen peroxide, which can be toxic to cells,to oxygen
Neporo4naja [7]

Answer:

yes

Explanation:

catalase is a carbohydrate

7 0
3 years ago
Other questions:
  • Regional metamorphism tends to make rocks more foliated.<br> True<br><br> False
    5·1 answer
  • Spring tides--
    13·1 answer
  • How do rates of mutation "power" molecular clocks?
    14·1 answer
  • From earth to space the main layers of the atmosphere are:
    11·1 answer
  • I'll GIVE YOU BRAINLIEST!!! A company develops a new weed-killing chemical. When the chemical is first used, it kills nearly all
    6·1 answer
  • suppose that a species of toads is introduced into a new environment in an attempt to reduce the population of insects.
    12·1 answer
  • If you treated embryos with a Notch inhibitor how would this affect the specification of venous and arterial endothelial cells?
    14·1 answer
  • What are the 5 branches of arthropods? Draw the evolutionary cladogram.
    5·1 answer
  • The plant cell below has some damaged organelles. What would MOST LIKELY result from this damage to the cell?
    9·1 answer
  • Geologists have special tools to help them learn more about how energy is carried in the lithosphere. If a geologist observed th
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!