1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tresset [83]
3 years ago
8

Help pls pls pls pls

Biology
1 answer:
Mashutka [201]3 years ago
3 0

Answer:

Reproduction

Explanation:

You might be interested in
Red-green color blindness is an x-linked recessive trait in humans. Two people with normal color vision have a son with colorbli
irakobra [83]
Father: XY
Mother: XX’

The father is normal, while the mother is a carrier.
7 0
2 years ago
Which of these is a body fossil. A shrimp burrow B dinasour bone C dinasour footprint D an ornithopod track
stepan [7]
C. Dinosaur footprint as it is the only body part that is stated in the choices.
Hope this helps :)

7 0
3 years ago
Read 2 more answers
Alu element at the PV92 locus on Chromosome 16. In this population, 436 people have a heterozygous genotype and 102 people have
Lesechka [4]

Answer:

Explanation:

According to the exercise we can infer that for the Alu insert:

p: positive allelic frequency

q: negative allelic frequency

maintaining that the population is in equilibrium we can carry out the following formula

p + q = 1 and pp + 2pq + qq = 1

looking for the genotype frequency we clear and obtain the following data

genotype frequency of 2pq = 436/1000 = 0.436

The genotype frequency of qq = 102/1000 = 0.102

This is how we look now:

number of positive people for Alu = 1000- (436 + 102) = 1000- 538 = 46

In this way it is resolved that:

genotypic frequency of pp = 462/1000 = 0.462

  p = 0.462 + (0.436 / 2) = 0.462 + 0.218 = 0.680

q = 0.102+ (0.436 / 2) = 0.102 + 0.218 = 0.320

According to the exercise carried out it is deduced:

The value of p in the population is = 0.68

We conclude that our prognosis showing a homozygous positive genotype is: 0.462

6 0
3 years ago
A change in the sequence of nitrogen<br> bases in a gene is called a(n)
Gnesinka [82]

Answer:

mutation

Explanation:

A mutation is a change that occurs in copying a DNA sequence where the order of the proteins could be altered.

3 0
3 years ago
Read 2 more answers
Which type of competition is depicted in this picture
bixtya [17]
The third one is ze answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • Why can the enzyme maltase, which breaks down into the sugar maltose, not also be used to break down the sugar sucrose?
    13·1 answer
  • 1. The speed of sound through a gas will increase if the following is also increased:
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which statement accurately describes how scientists collect data
    13·2 answers
  • Why is oxygen important for maintaining your muscles functions
    6·1 answer
  • Gene therapy is an integral part of genome projects. It includes the correction of abnormal genes responsible for diseases. Whic
    14·2 answers
  • What allows substances to go through the cell?
    13·2 answers
  • In science, theories____?
    5·1 answer
  • Suggest why drugs that prevent this reflex action from occurring should be avoided.
    13·1 answer
  • In translation, what would be the correct trna anticodon for the codon acc?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!