1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mihalych1998 [28]
2 years ago
5

A poly A tail is added to the mature mRNA after transcription True or false

Biology
1 answer:
nalin [4]2 years ago
5 0

Answer:

The answer is True

You might be interested in
What is the function of bile? *
Ray Of Light [21]

Answer:

Your answer is A) Emulsify Fats.

7 0
3 years ago
write a hyp“what is the effect of magnification on the visibility of cell organelles under a microscope?” othesis that
Alexxandr [17]
The magnification will provide better visibility and more detailed information.
7 0
3 years ago
The different degrees of sleep and wakefulness through which newborns cycle, ranging from deep sleep to great agitation, are cal
Alecsey [184]
The different degrees of sleep and wakefulness through which newborns cycle, ranging from deep sleep to great agitation, are called states of arousal. These states are regular sleep, irregular sleep, drowsiness, quiet alertness and crying. About eight to nine hours each of an infant's day is dedicated to regular and irregular sleep. So, most of the time of the infant is spent in these states. These are the states where the brain of an infant is developing the important connections for growth and survival. Crying is the means for infants to communicate their needs. Different type of cries would represent different needs of the infant.
7 0
3 years ago
Scare Monsters can be blue, purple or blue with purple spots. If we
zysi [14]

Answer:

Incomplete Dominance

Explanation:

Its incomplete dominance because if it has anything to do with colors blending to make anything new its always going to be incomplete dominance.

3 0
3 years ago
Fruit flies have 3 chromosomes plus sex chromosomes (X and Y). Mutations occurred within four different cells of an
kifflom [539]

Answer:

Its either curly wings or yellow body

Explanation:

6 0
3 years ago
Other questions:
  • A standard of comparison in an experiment is called the
    9·1 answer
  • Can someone help me to write conclusion about nervous system in human
    8·2 answers
  • What basic unit of heredity is found on segments of DNA and are passed on from parent to offspring? nucleotide gene phosphate mo
    8·2 answers
  • In what ways might anna's infection have played a role in her untimely death?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Describe what types of foods people should eat regularly to prevent nutrient deficiencies.
    6·1 answer
  • **PLEASE ANSWER ASAP**. Describe the appearance of the vacuole in a well-watered plant. What effect would this have on the cell
    12·1 answer
  • Easy question easy points here
    9·2 answers
  • Do ocean currents affect aquatic life? What do you think and why?
    10·1 answer
  • What is a phenotype?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!