1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
15

Does addiction contribute to martial problems? Yes or No? and why?

Biology
1 answer:
yuradex [85]3 years ago
6 0

Answer:

Yes. It contributes to marital problems because for example lets say you have a husband that is addicted to alcohol he is going to spend hundreds of dollars on alcohol every month and you are eventually going to get tired of not having enough money to pay the bills and get groceries. If your husband doesn't get rehab if will eventually get worse & rehab also costs money. Nobody will want to put up with that. Another example is if your husband is addicted to gambling your money is going to go down the drain very quickly leaving you bankrupt and most of the times people that get very involved with gambling gets mixed in with the wrong people.  

Explanation:

These are examples of how addictions can contribute to problems in a marriage.

:)))

You might be interested in
The hemoglobin of sickle cell anemia:
Kitty [74]

Answer:

2. Can carry less oxygen and more carbon dioxide.

Explanation:

Sickle cell anemia damages and inhibits hemoglobin in red blood cells reducing how much oxygen they can carry.

3 0
3 years ago
Do you think there’s enough evidence to suggest that parthenogenesis alone will save the sawfish? Explain your answer.
quester [9]

Answer:

yes their is

Explanation:

I don,t really know how to explain my answer

5 0
3 years ago
Read 2 more answers
Two chromosomes control gender. What combination of these chromosomes will result in a male drake versus a female drake?
VikaD [51]
A male drake will result with XY chromosome and a female drake would have XX chromosomes
4 0
3 years ago
PLZZZZZZ HELP ME how plants help provide oxygen for animals
VLD [36.1K]
Because people and animals exhale carbon dioxide which plants need and they release oxygen
3 0
3 years ago
Read 2 more answers
Can a plant grow better in dirt or soil
Phoenix [80]
It could go either way but I would say soil. Hope this helps.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What effect does inbreeding have on a population?
    10·1 answer
  • what conditions create the largest waves in the ocean enter your answer in the space provided please help !!! ​
    9·2 answers
  • Define population. How is a population different from a community
    12·2 answers
  • AM I CORRECT??
    15·2 answers
  • Hi! i’ll give brainliest please help
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Describe the three types of mammals. Give examples of each. How is reproduction/offspring different in each?
    15·2 answers
  • Can somebody solve this problem for me please
    13·1 answer
  • Identify an area on Earth that has a high level of biodiversity, and the correlation with threats to various species.
    6·2 answers
  • ASAP plz
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!