Nature is genes. Nurture is how someone or something is grown/ raised. Scientists believe both are important, so they do not choose one over the other.
I hope this helps.
Explanation:
the answer is not A, B,D now get it it is Clear C protists
Answer:
Carbon, oxygen, hydrogen, nitrogen, and phosphorus are all involved in creating genetic material.
Explanation:
Answer:
The chemicals left over after a chemical reaction are substrates or resultants.
yellow represents carbon so there are 6 carbon atoms.
blue represents hydrogen/water atoms so
Red represents the oxygen atoms bonded to the hydrogen atoms.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
