Answer:
It prevents their species from going extinct.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
The correct answer will be option-B
Explanation:
Meiosis is a way of cell division used by the organism to produce a large number of cells from a few parent cells. This is used to make the gametes of the body.
Meiosis produces four daughter cells from a single parent cell in two stages that is meiosis I and II. Each stage proceeds in four phases- prophase, metaphase, anaphase and telophase.
The reduction division of the chromosomes or the ploidy number takes place during anaphase I of meiosis I and not prophase I which is the initial phase of the division. Therefore, during prophase I the chromosome number of the cell remains the same.
Thus, Option-B is the correct answer.
Answer:
C. 3 types
- cardiac, smooth and skeletal tissue
The answer is D. Coral reefs are built from stony corals, which in turn consist of polyps that cluster in groups. The polyps belong to a group of animals known as Cnidaria, which also includes sea anemones and jellyfish. Unlike sea anemones, corals secrete hard carbonate exoskeletons which support and protect the coral polyps. Most reefs grow best in warm, shallow, clear, sunny and agitated water. @wiki Hope this helps and if your feeling generous give it a rate, thanks and brainliest because it would really help me get virtuoso and I would appreciate it ;)
