1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrMuchimi
3 years ago
11

Special senses, such as sight and sound, are detected by:

Biology
1 answer:
Leviafan [203]3 years ago
8 0
<span>The special senses of sight and sound are detected by, special cells that transduce stimuli into electrical signals. In the visual system, sensory cells in the retina convert the physical energy of light signals into electrical impulses that travel to the brain.</span>
You might be interested in
What design advantages can you identify in the location of the battery
nikdorinn [45]
Is this science?? Also may I hv options.
8 0
3 years ago
What is the process of water moving down through the soil called?
Alisiya [41]

Answer:

The answer is B the girl is wright

4 0
3 years ago
Under a microscope, a student observes a specimen containing a cell wall, nucleus, and chloroplasts.
mart [117]

Answer:

A plant cell b/c it has chloroplast

Explanation:

Chloroplast absorbs sunlight also known as light energy used for the process of photosynthesis.

5 0
4 years ago
Read 2 more answers
Name three impurities found in water​
Mashcka [7]

Answer:

ya mum ya cant get rid of meh!!!

Explanation:

4 0
3 years ago
Do you think that the cell theory or the organismal theory is more important? Why?
hoa [83]

Answer:

The organismal theory

Explanation:

Because the organismal is the scientific study behind how our bodies work =) hope this helped

7 0
3 years ago
Other questions:
  • An important response mechanism in our bodies is blood clotting. The response loop is initiated when injured tissue releases sig
    5·1 answer
  • During the sequencing of the chimpanzee genomes, a gene (cmah) was identified that completely lost an exon in human when compare
    15·1 answer
  • In a __________, organisms are particularly susceptible to certain kinds of stimuli in their environments, but the absence of th
    5·2 answers
  • Why is it necessary to group herbs into garden beds?
    9·1 answer
  • There is no single "ideal" weight or size. Instead, individuals should aim for a weight that encourages healthful habits and doe
    6·1 answer
  • 20 POINTS!!!!!!
    9·1 answer
  • Describe how magma forms minerals by completing the flow chart below
    5·2 answers
  • according to the most recent science,if everyone where to live in california,carrying a capacity of planet eart is appromixatley
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What organelle inside of a cell reads the RNA and constructs the protein?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!