1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
3 years ago
8

Pascal's principle deals with fluid at rest.

Biology
1 answer:
Katen [24]3 years ago
4 0
T.............................
You might be interested in
Which contribution from international organizations to fight disease is most necessary?
nlexa [21]
World Health Organization
8 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
27. What adaptation do organisms that live in an estuary have?
Kamila [148]
The answer is B, or They can survive in changing salinity.
7 0
2 years ago
Read 2 more answers
What were Louis Pasteur's experiments related to spontaneous generation?
Tamiku [17]
Spontaneous generation was a (refuted) theory that some forms of life can arise from inorganic matter. 

Louis Pasteur refuted it in a series of experiments, in which he boiled different matter (grape juice, broth) which would kill all the bacteria and let it stay for a long time to see if it would develop life (he also had a control condition in which he let the boiled liquid interact with the outside words, and those would develop bacterial life). 
4 0
3 years ago
What is one potential benefit and one potential negative impact of genetically engineering crops?
strojnjashka [21]

Answer:

potential benefit: more nutritious food

potential negative impact:biodiversity loss

3 0
2 years ago
Other questions:
  • Plz help me!
    7·2 answers
  • What is genetic recombination and how does it occur in linked genes?
    13·1 answer
  • Biodiversity enhances ________ because it provides genetic diversity and the potential for developing more productive food crops
    5·1 answer
  • Organelles Quick Check
    10·1 answer
  • "Sunlight is required for plant growth. When light energy is absorbed by a leaf, after a series of chemical reactions, the light
    12·1 answer
  • In the above problem, if pollution causes the tree to darken, tell what will happen to the insect populations over time and how
    9·1 answer
  • Describes natural selection?
    6·1 answer
  • Which of the following characteristics cannot be influenced by the environment? A. Chance of having diabetes B. Metabolism C. Na
    14·2 answers
  • Help me pls i will mark you as brainliest
    12·2 answers
  • What do all consumers have in common?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!